ttll6 Antibody

Shipped with Ice Packs
In Stock

Description

Introduction to TTLL6 Antibody

TTLL6 antibodies target the TTLL6 enzyme, which catalyzes α-linked polyglutamylation of α-tubulin tails—a process critical for microtubule stability and function . These antibodies are typically developed against specific epitopes of TTLL6, enabling detection in Western blotting, immunofluorescence, and immunohistochemistry assays.

Key Research Applications

Cancer chemotherapy resistance studies
TTLL6 antibodies have been instrumental in identifying TTLL6's role in reversing cisplatin (CDDP) resistance in esophageal carcinoma (EC) cells. Key findings include:

Experimental ConditionTTLL6 ExpressionIC50 of CDDPApoptosis Rate
Hypoxia/acidosisOverexpression↓ 18-fold↑ 45%
Hypoxia/acidosisKnockdown↑ 22-fold↓ 15%
Data derived from EC109/CDDP cell models .

Microtubule dynamics research
TTLL6 antibodies help visualize how TTLL6-generated long glutamate chains (detected by polyE antibodies) destabilize microtubules by activating severing proteins like spastin and katanin . Comparative effects:

EnzymeGlutamate Chain LengthMT Mass ReductionSevering Protein Activation
TTLL6Long (α-linked)70%Spastin, katanin
TTLL4ShortNo changeMinimal

Clinical Implications

In xenograft models, TTLL6 overexpression suppressed tumor growth post-CDDP treatment by modulating:

  • Downregulation: ERBB2 (HER2) and TOPOIIA (chemoresistance markers)

  • Upregulation: Caspase 9 (apoptosis effector) .

Technical Considerations

  • Antibody validation: Requires cross-reactivity checks due to TTLL6’s paralogues (12 in humans) .

  • Epitope selection: Prioritize regions outside catalytic domains (e.g., residues 480-550) to avoid activity interference .

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
ttll6 antibody; Tubulin polyglutamylase ttll6 antibody; EC 6.-.-.- antibody; Tubulin tyrosine ligase-like family member 6 antibody
Target Names
ttll6
Uniprot No.

Target Background

Function
TTLL6 is a polyglutamylase enzyme that modifies both tubulin and non-tubulin proteins. It catalyzes the addition of alpha-linked polyglutamate side chains to the gamma-carboxyl group of specific glutamate residues within target proteins. TTLL6 exhibits a preference for elongating long polyglutamate chains in an ATP-dependent manner, rather than initiating the polyglutamylation process. It preferentially modifies the alpha-tubulin tail over the beta-tail. TTLL6 plays a crucial role in microtubule polyglutamylation within cilia axonemes, contributing to ciliary structural integrity and motility. It specifically polyglutamylates olfactory cilia, regulating their structure and beating patterns.
Gene References Into Functions
  1. Research has shown that the tubulin tyrosine ligase-like genes ttll3 and ttll6 are essential for maintaining cilia structure and motility in zebrafish. PMID: 21262966
Database Links
Protein Families
Tubulin--tyrosine ligase family
Subcellular Location
Cytoplasm. Cytoplasm, cytoskeleton. Cytoplasm, cytoskeleton, cilium axoneme. Cytoplasm, cytoskeleton, cilium basal body.

Q&A

What is TTLL6 and why study it using antibody-based approaches?

TTLL6 is a tubulin polyglutamylase that belongs to the Tubulin Tyrosine Ligase-like protein family. It specifically mediates ATP-dependent long polyglutamate chain elongation rather than initiation of polyglutamylation reactions . TTLL6 preferentially modifies alpha-tubulin tails over beta-tubulin tails and promotes tubulin polyglutamylation which stimulates spastin/SPAST-mediated microtubule severing .

The significance of studying TTLL6 via antibody approaches stems from its roles in:

  • Microtubule cytoskeleton organization and protein polyglutamylation

  • Ciliary structural formation and motility

  • Potential involvement in disease mechanisms (Joubert Syndrome 33, Meckel Syndrome)

  • Drug resistance reversal in cancer cells under hypoxic conditions

Methodologically, researchers should employ multiple detection techniques (Western blot, IHC, IF) to confirm findings, as TTLL6's expression pattern is tissue-specific with highest levels in testis, nasopharynx, fallopian tube, and bronchus .

Which applications are most reliable for TTLL6 antibody detection?

ApplicationReliabilityOptimal DilutionCommon IssuesRecommended Validation
Western BlotHigh1:500-1:5000Multiple bands (97kDa, 65kDa)U87 whole cell lysate as positive control
IHC (Paraffin)Moderate-High1:500-1:1000Background in highly expressing tissuesHuman testis tissue recommended
ImmunofluorescenceModerate1:200-1:1000Nonspecific bindingCo-staining with ciliary markers
ELISAHighAssay-dependentLimited functional informationRecombinant protein standards

For optimal detection, researchers should validate antibodies using positive control tissues known to express TTLL6 (testis, nasopharynx) and negative control tissues/knockdown samples . For Western blotting, the expected band size is approximately 97 kDa for the canonical form, though additional bands may appear due to isoforms or post-translational modifications .

How should researchers optimize immunodetection protocols for TTLL6?

When optimizing immunodetection of TTLL6, consider these methodological approaches:

For Western blot:

  • Use fresh lysates with protease inhibitors to prevent degradation

  • Optimize protein loading (50-100 μg total protein recommended)

  • For membrane transfer, extended transfer times (>1 hour) may improve detection of the 96.4 kDa protein

  • Block with 5% BSA rather than milk to reduce background

  • Primary antibody incubation at 4°C overnight yields best results

  • Expected band: 97 kDa canonical form

For IHC:

  • Antigen retrieval is critical—use high-pressure citrate buffer (pH 6.0)

  • Block with 10% normal goat serum for 30 minutes at room temperature

  • Primary antibody incubation at 4°C overnight in 1% BSA

  • Detect using biotinylated secondary antibody and HRP-conjugated detection system

  • Consider dewaxing and hydration steps for paraffin-embedded tissues

For all applications, include both positive controls (U87 cells) and negative controls (secondary antibody alone or isotype control) .

How can researchers use TTLL6 antibodies to investigate cilia formation and function?

TTLL6 plays a critical role in cilia formation and function through its polyglutamylation activity. To effectively study this:

  • Co-localization studies: Use TTLL6 antibodies in conjunction with known ciliary markers (e.g., acetylated tubulin) via immunofluorescence microscopy to assess localization to the ciliary basal body .

  • Functional analysis protocol:

    • Express EYFP-tagged TTLL6 constructs in cells with primary cilia

    • Assess glutamylation patterns using both GT335 antibody (detects initial branching point) and B3 antibody (recognizes elongated chains)

    • Monitor ciliary dynamics through live imaging of EB3 comets to observe microtubule stability changes

    • Compare results with other TTLL family members (TTLL1, TTLL4, TTLL7) to distinguish elongator vs. initiator functions

  • Knockdown studies methodology:

    • Design antisense morpholinos targeting TTLL6 splice sites (e.g., ttll6ATGMo: CTGGTGTCCCCATTCTGATCTCTTC)

    • Assess effects on cilia ultrastructure using transmission electron microscopy

    • Quantify cilia motility using high-speed videomicroscopy

    • Consider combinatorial knockdown with other TTLL family members (e.g., TTLL3) to identify synergistic effects on ciliary structure and function

Research suggests that knockdown of TTLL6 strongly reduces cilia tubulin glutamylation but only partially affects cilia structure and motility, indicating functional redundancy with other TTLLs .

What approaches enable discrimination between TTLL6 and other TTLL family members?

Distinguishing TTLL6 from other TTLL family members requires careful experimental design:

  • Antibody selectivity strategy:

    • Use antibodies targeting non-conserved regions (e.g., C-terminal domains)

    • Validate specificity using knockout/knockdown cells or tissues

    • Employ epitope-tagged recombinant proteins as controls

  • Functional discrimination approach:

    • TTLL6 functions primarily as a glutamate chain elongator rather than initiator

    • Use B3 antibody to detect elongated glutamate chains (TTLL6 activity) vs. GT335 antibody for detecting initial glutamylation (TTLL4/TTLL5 activity)

    • Quantitative substrate specificity: TTLL6 preferentially modifies α-tubulin over β-tubulin tails

  • Expression pattern analysis:

    • TTLL6 expression is highest in ciliated epithelia (pronephros, olfactory placodes, lateral line organs)

    • Compare with expression patterns of other TTLLs: TTLL1 (brain neurons), TTLL4 (muscle), TTLL7 (otic placodes)

TTLL Family MemberPrimary FunctionPreferred SubstrateExpression PatternAntibody Detection
TTLL6Elongatorα-tubulinCiliated epitheliaB3 antibody positive
TTLL4Initiatorα/β-tubulinMuscleGT335 antibody positive
TTLL7Bothβ-tubulinOtic placodesBoth antibodies positive
TTLL1Complex componentα-tubulinBrain neuronsComplex-dependent activity

These distinguishing characteristics allow for precise experimental design when studying specific TTLL family members.

How can TTLL6 antibodies be employed to investigate drug resistance mechanisms in cancer cells?

Recent research indicates TTLL6 may play a role in drug resistance, particularly in esophageal carcinoma cells. To study this function:

  • Expression analysis protocol in drug-resistant cancer models:

    • Compare TTLL6 protein levels in parental and drug-resistant cell lines (e.g., EC109 vs. EC109/CDDP cells) using Western blot with optimized TTLL6 antibodies

    • Conduct IHC on tumor samples before and after chemotherapy to correlate TTLL6 expression with treatment response

  • Mechanistic investigation methodology:

    • Establish stable TTLL6 overexpression and knockdown cell lines using lentiviral transduction

    • Assess drug sensitivity using MTT/CCK-8 assays in both hypoxic/acidic and neutral microenvironments

    • Analyze apoptosis signaling pathways (ERBB2, TOPOIIA, Caspase 9) via co-immunoprecipitation with TTLL6 antibodies

    • Evaluate xenograft tumor growth in response to chemotherapy after TTLL6 manipulation

  • Microenvironmental influence assessment:

    • Culture cells in hypoxic (1% O₂) and acidic (pH 6.5) conditions to mimic tumor microenvironment

    • Compare TTLL6-dependent effects between normal and hypoxic/acidic conditions

    • Use TTLL6 antibodies to track subcellular localization changes under stress conditions

Research demonstrates that overexpression of TTLL6 significantly lowers the IC₅₀ of cisplatin and increases cisplatin-induced apoptosis in EC109/CDDP cells under hypoxic/acidic conditions. This effect correlates with inverse regulation of ERBB2 and TOPOIIA, and positive correlation with Caspase 9 .

What are the technical considerations for studying TTLL6-mediated tubulin modifications?

Analyzing TTLL6-mediated tubulin modifications requires sophisticated technical approaches:

  • In vitro polyglutamylation assay protocol:

    • Express and purify recombinant TTLL6 protein

    • Prepare purified tubulin or microtubules as substrates

    • Perform in vitro glutamylation reactions with [¹⁴C]-glutamate

    • Analyze products using SDS-PAGE and autoradiography or mass spectrometry

    • Compare modification patterns between free tubulin and polymerized microtubules

  • Structural analysis of TTLL6-tubulin interactions:

    • TTLL6 contains an MTBD domain that recognizes β-tubulin and an MTBH1-2 domain that bridges adjacent tubulin dimers

    • Mutations in key residues (R415, R418, L409, V422) significantly affect TTLL6 activity with microtubules but not with isolated α-tail peptides

    • Consider these residues when designing experiments to differentiate substrate preference

  • Trans-modification mechanism study:

    • TTLL6 modifies α-tubulin tails in trans, an unprecedented mechanism among tubulin modification enzymes

    • This ensures modification of tubulin dimers only after polymerization into microtubules

    • Use cryo-electron microscopy coupled with enzyme kinetic analysis and single-molecule fluorescence to visualize this process

TTLL6 DomainFunctionKey ResiduesEffect of Mutation
MTBDβ-tubulin recognitionR415, R418~47% decrease in activity
MTBH1-2Bridges adjacent dimersL409, V422>90% decrease in activity
α11-α12 interfaceStabilizing interactionsF408, F425~70% increase in activity

Understanding these technical aspects is crucial for designing experiments to study TTLL6's unique polyglutamylation mechanisms.

What experimental approaches can reveal the relationship between TTLL6 and microtubule dynamics?

Investigating how TTLL6 affects microtubule dynamics requires specialized techniques:

  • Live cell imaging methodology:

    • Express fluorescently-tagged TTLL6 alongside microtubule markers

    • Use TIRF or spinning disk confocal microscopy for high temporal resolution

    • Track EB3 comets to analyze microtubule growth rates, catastrophe frequency, and rescue events

    • Compare TTLL6 effects with other TTLL family members to identify specific contributions

  • In vitro reconstitution experiments:

    • Purify recombinant TTLL6 protein

    • Set up dynamic microtubule assays with purified tubulin

    • Add TTLL6 at varying concentrations to assess dose-dependent effects

    • Visualize using TIRF microscopy with fluorescently labeled tubulin

  • Microtubule severing analysis:

    • TTLL6 promotes tubulin polyglutamylation which stimulates spastin/SPAST-mediated microtubule severing

    • Co-express TTLL6 and spastin to assess synergistic effects

    • Quantify microtubule length and number before and after treatment

    • Use site-directed mutagenesis of key TTLL6 residues to disrupt specific functions

  • Microtubule bundle formation assessment:

    • TTLL6 is predicted to act upstream of microtubule bundle formation

    • Use super-resolution microscopy to visualize bundle architecture

    • Analyze bundle thickness, stability, and composition after TTLL6 manipulation

    • Consider counterstaining with post-translational modification-specific antibodies

Research indicates that TTLL6 expression disrupts microtubule stability, as demonstrated through live-cell imaging of microtubule plus-end tracking protein EB3 comets .

How can researchers address common issues with TTLL6 antibody experiments?

IssuePotential CauseSolutions
No signal in Western blotLow TTLL6 expressionUse tissues with known high expression (testis, nasopharynx) ; Concentrate protein sample
Multiple bandsIsoforms or degradationUse fresh samples with protease inhibitors; Compare with predicted sizes (97kDa, 65kDa)
High background in IHCNonspecific bindingOptimize blocking (10% normal goat serum) ; Titrate antibody concentration
Inconsistent results between applicationsApplication-specific epitope accessibilityUse antibodies validated for specific applications; Consider multiple antibodies targeting different regions
Cross-reactivity with other TTLL membersConserved domainsUse highly specific antibodies targeting unique regions; Include appropriate controls
Poor reproducibilityTechnical variationsStandardize protocols; Use consistent lots of antibodies; Include positive controls

When troubleshooting, consider that TTLL6 expression is tissue-specific and may be influenced by experimental conditions. Particularly challenging can be detection in cells with primary cilia, where expression may be localized to small subcellular structures requiring high-resolution imaging techniques.

What controls are essential for validating TTLL6 antibody specificity?

To ensure reliable results, implement these validation controls:

  • Positive tissue controls:

    • Human testis tissue (shows strong expression)

    • Nasopharynx, fallopian tube, bronchus samples

    • U87 whole cell lysate (validated for Western blot)

  • Negative controls:

    • Tissues known to lack TTLL6 expression

    • TTLL6 knockdown/knockout samples using:

      • Antisense morpholinos (e.g., ttll6ATGMo: CTGGTGTCCCCATTCTGATCTCTTC)

      • shRNA constructs (pLKO.1-shRNA/TTLL6)

  • Recombinant protein standards:

    • Use purified TTLL6 protein as positive control

    • Test antibody against recombinant fragments of TTLL6 to confirm epitope recognition

  • Cross-reactivity assessment:

    • Test against other TTLL family members (especially TTLL1, TTLL4, TTLL7)

    • Include both human and animal samples if studying across species

  • Methodological controls:

    • Secondary antibody only

    • Isotype control antibody at matching concentration

    • Pre-absorption with immunizing peptide to confirm specificity

Implement these controls systematically to distinguish true signals from artifacts and ensure reliable interpretation of experimental results.

What emerging applications of TTLL6 antibodies show promise for advancing tubulin research?

Several innovative approaches using TTLL6 antibodies are poised to advance the field:

  • Proximity-based protein modification mapping:

    • Use TTLL6 antibodies in BioID or APEX2 proximity labeling systems

    • Identify proteins within the TTLL6 interactome during specific cellular processes

    • Map the spatiotemporal dynamics of TTLL6-mediated polyglutamylation

  • Super-resolution imaging of tubulin modification patterns:

    • Combine TTLL6 antibodies with super-resolution techniques (STORM, PALM)

    • Visualize nanoscale distribution of polyglutamylation along microtubules

    • Correlate with functional outcomes (stability, severing, motor protein trafficking)

  • Dual-modification detection systems:

    • Develop antibody-based sensors that simultaneously detect TTLL6 and its modified substrates

    • Track the kinetics of modification in real-time

    • Apply to high-throughput screening for modulators of tubulin polyglutamylation

  • Single-molecule studies:

    • Use antibody fragments to track individual TTLL6 molecules

    • Analyze the processivity and dynamics of TTLL6 on individual microtubules

    • Determine how polyglutamylation patterns develop along microtubules

These approaches will help address fundamental questions about how TTLL6-mediated tubulin modifications contribute to cellular functions and disease mechanisms.

How might TTLL6 antibodies contribute to understanding disease mechanisms?

TTLL6 antibodies offer valuable tools for investigating several disease contexts:

  • Ciliopathies research:

    • TTLL6 is associated with Joubert Syndrome 33 and Meckel Syndrome, Type 1

    • Use antibodies to assess TTLL6 expression, localization, and activity in patient samples

    • Develop diagnostic approaches based on altered polyglutamylation patterns

  • Cancer chemoresistance mechanisms:

    • TTLL6 expression significantly increased in reversed cisplatin-resistant EC cells (EC109/CDDP/WIG-1)

    • Map TTLL6 expression changes during acquisition of drug resistance

    • Correlate with clinical outcomes in patient tumor samples

    • Investigate the intersection between hypoxia, acidosis, and TTLL6-mediated polyglutamylation

  • Neurodegeneration pathways:

    • Tubulin polyglutamylation has been linked to neurodegeneration

    • Analyze TTLL6 distribution in neurodegenerative disease tissues

    • Track age-dependent changes in TTLL6 activity and polyglutamylation patterns

  • Reproductive disorders:

    • TTLL6 participates in apoptosis-related spermatogenesis

    • Use antibodies to assess TTLL6 expression in infertility cases

    • Investigate potential diagnostic applications in reproductive medicine

These applications demonstrate the broad utility of TTLL6 antibodies beyond basic research into clinically relevant areas.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.