TUBB2B Antibody

What is TUBB2B and what cellular functions does it perform?

TUBB2B (Tubulin beta 2B class IIb) is a beta isoform of tubulin that binds GTP and serves as a major component of microtubules. It is primarily expressed in developing neurons with dominant expression during critical steps of corticogenesis. TUBB2B plays an essential role in neuronal migration and is present in nuclei and nucleoplasm. The protein binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain . Defects in this gene are associated with asymmetric polymicrogyria. Recent research has also implicated TUBB2B in epithelial-mesenchymal transition (EMT) in glioblastoma, suggesting its significant role in cancer cell migration and invasion. TUBB2B has been found to physically interact with Vimentin to induce EMT, thereby promoting migration and invasion in GBM cells .

What applications can TUBB2B antibodies be used for in research?

TUBB2B antibodies have demonstrated utility across multiple research applications with specific methodological considerations for each:

These applications enable researchers to investigate TUBB2B expression, localization, and interactions in various experimental contexts .

How should I validate the specificity of TUBB2B antibodies in my experimental system?

Proper validation of TUBB2B antibody specificity is crucial for generating reliable and reproducible research data. A multi-pronged approach is recommended:

• Positive and negative control samples: Utilize tissues or cell lines known to express or not express TUBB2B. GBM cell lines (T98, LN229) have been shown to exhibit high TUBB2B expression, while normal astrocyte cell lines (HA1800) show lower expression levels .

• Knockdown/knockout validation: Compare antibody staining patterns in TUBB2B-knockdown cells (using siRNA or shRNA) with control cells. This approach confirms whether the signal decreases when the target protein is depleted.

• Peptide competition assay: Pre-incubate the antibody with the immunizing peptide (Recombinant Human TUBB2b (1-445aa) in the case of the AT5B3 clone) before application to verify that binding is specific .

• Western blot analysis: Confirm a single band at the expected molecular weight (~50 kDa) for TUBB2B.

• Cross-reactivity testing: Since TUBB2B belongs to the tubulin family with highly conserved regions, verify the antibody doesn't cross-react with other tubulin isoforms.

What are the optimal storage and handling conditions for TUBB2B antibodies?

To maintain optimal TUBB2B antibody performance over time, follow these evidence-based storage and handling practices:

• Short-term storage: Store undiluted antibody at 2-8°C for up to two weeks .

• Long-term storage: Aliquot the antibody and store at -20°C for extended periods .

• Avoid freeze-thaw cycles: Repeated freezing and thawing significantly reduces antibody efficacy. Make small aliquots to minimize the number of freeze-thaw cycles.

• Buffer conditions: TUBB2B antibodies are typically supplied in PBS, pH 7.4, containing 0.02% Sodium Azide and 10% Glycerol . Maintain these conditions when making working dilutions.

• Shelf life considerations: Commercial TUBB2B antibodies typically have a shelf life of one year from the dispatch date when stored properly .

• Working solution preparation: Prepare fresh working dilutions on the day of the experiment for optimal results.

How can I effectively design experiments to study TUBB2B-Vimentin interactions in cancer research?

Research has identified a critical interaction between TUBB2B and Vimentin that regulates epithelial-mesenchymal transition (EMT) in glioblastoma. To investigate this interaction, implement these methodological approaches:

• Co-immunoprecipitation (Co-IP): Use TUBB2B antibody-conjugated magnetic beads to pull down protein complexes, then probe for Vimentin using western blotting. This confirms physical interaction between the proteins .

• Molecular docking and mutation analysis: The interaction between TUBB2B and Vimentin has been mapped to specific sites. In particular, the R391/K392/A393/F394 region of TUBB2B is critical for this interaction. Create site-directed mutants (e.g., TUBB2B-Mut4(R391D/K392W/A393H/F394E)) to disrupt the interaction and assess functional consequences .

• Functional validation: Perform Transwell and wound healing assays comparing cells expressing wild-type TUBB2B versus mutant TUBB2B (particularly the TUBB2B-Mut4 variant). Research has demonstrated that TUBB2B-Mut4 attenuates invasion and migration ability compared to TUBB2B-NC .

• Immunofluorescence co-localization: Perform dual immunofluorescence staining for TUBB2B and Vimentin to visualize co-localization in cellular contexts, which provides spatial information about their interaction.

• In vivo validation: Establish xenograft models using cells with TUBB2B knockdown or expressing TUBB2B mutants to assess the impact on tumor invasion patterns and EMT marker expression .

What methodological approaches should I use to investigate TUBB2B's role in glioblastoma progression?

TUBB2B has been implicated in glioblastoma (GBM) progression through its ability to regulate EMT and promote cell migration and invasion. To thoroughly investigate this role:

• Expression analysis: Compare TUBB2B mRNA and protein levels between GBM tissues/cell lines and normal brain tissues/cells. Research has consistently shown upregulation of TUBB2B in GBM tissue samples compared with normal tissues .

• Knockdown and overexpression studies:

  • For knockdown: Use lentiviral vectors (e.g., pLV-hU6-TUBB2BshRNA03-hef1a-mNeongreen-P2A-Puro) targeting TUBB2B (sequence: GCTGGAGAGAATCAATGTTTA) .

  • For overexpression: Use expression vectors (e.g., Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin) .

  • Verify knockdown/overexpression efficiency by western blotting.

• Migration and invasion assays:

  • Transwell assays to quantify invasive potential

  • Wound healing assays to measure migration capacity

  • Research has shown that TUBB2B knockdown significantly reduces invasion and migration in GBM cell lines, while overexpression enhances these capabilities .

• EMT marker analysis: Assess changes in EMT markers (e.g., Vimentin, N-cadherin, E-cadherin) following TUBB2B modulation using western blotting and immunofluorescence .

• In vivo orthotopic models: Inject TUBB2B-modulated GBM cells into the caudate nucleus of nude mice and analyze:

  • Tumor margin characteristics and invasive patterns

  • Survival outcomes (TUBB2B knockdown has been shown to prolong survival in mouse models)

  • EMT marker expression in tumor tissues through immunohistochemical staining

What considerations are important when using TUBB2B antibodies for co-immunoprecipitation experiments?

Co-immunoprecipitation (Co-IP) is crucial for investigating TUBB2B protein interactions. For optimal Co-IP experiments with TUBB2B antibodies:

• Lysis buffer optimization: Use lysis buffer containing protease inhibitor cocktail to preserve protein-protein interactions. Standard lysis buffers used in TUBB2B-Vimentin co-IP studies maintain native protein structures while efficiently extracting membrane-associated proteins .

• Antibody selection: Choose antibodies validated for immunoprecipitation applications. For TUBB2B, monoclonal antibodies often provide more consistent results than polyclonal antibodies.

• Immobilization method: Use magnetic beads conjugated with primary antibodies for efficient pull-down. Incubate the total cell lysate with antibody-conjugated beads at room temperature for approximately 2 hours .

• Washing protocols: After immunoprecipitation, perform thorough washing to remove non-specifically bound proteins while preserving specific interactions.

• Controls: Include:

  • Input control (pre-immunoprecipitation lysate)

  • IgG control (same species as the primary antibody)

  • Negative control (cells with TUBB2B knockdown)

• Detection method: Use western blotting to detect co-immunoprecipitated proteins (e.g., Vimentin when TUBB2B is immunoprecipitated) .

• Reciprocal Co-IP: Confirm interactions by performing the reverse experiment (immunoprecipitate with Vimentin antibody and detect TUBB2B) .

How can I design mutational studies to investigate functional domains of TUBB2B?

Mutational analysis is powerful for understanding structure-function relationships in TUBB2B. Based on recent research:

• Identification of critical regions: Previous studies have identified important functional domains in TUBB2B, including:

  • N99/N100 region (TUBB2B-Mut1)

  • P173-V182 region (TUBB2B-Mut2)

  • T218-P220 region (TUBB2B-Mut3)

  • R391-F394 region (TUBB2B-Mut4)

• Construction of mutants: Generate lentivirus-mediated RNA constructs with specific mutations:

  • TUBB2B-Mut1 (N99P/N100W)

  • TUBB2B-Mut2 (P173Y/K174P/V175W/S176Y/D177R/T178Y/V179D/V182Y)

  • TUBB2B-Mut3 (T218G/T219S/P220H)

  • TUBB2B-Mut4 (R391D/K392W/A393H/F394E)

• Expression system: Transfect mutant constructs into appropriate cell lines (e.g., LN229, T98, HEK293T cells) and select transfected cells using puromycin (2 μg/mL) .

• Functional validation: Assess the impact of mutations on:

  • Protein-protein interactions (Co-IP with potential binding partners like Vimentin)

  • Cell migration and invasion (Transwell and wound healing assays)

  • EMT marker expression (Western blot and immunofluorescence)

• Structural analysis: Combine experimental data with molecular docking simulations to understand how mutations affect protein structure and interaction surfaces .

What in vivo models are appropriate for studying TUBB2B function in neuronal development and cancer?

Selecting appropriate in vivo models is crucial for understanding TUBB2B's role in different biological contexts:

• For neuronal development studies:

  • Mouse models with TUBB2B mutations to recapitulate human polymicrogyria

  • In utero electroporation to introduce wild-type or mutant TUBB2B into developing mouse brain

  • Time-lapse imaging of neuronal migration in brain slices

• For cancer research (particularly glioblastoma):

  • Orthotopic xenograft models: Inject TUBB2B-modified GBM cells (knockdown, overexpression, or mutant) into the caudate nucleus of nude mice .

  • Assessment parameters:

    • Tumor margins and invasive patterns

    • Survival outcomes (TUBB2B knockdown has been shown to prolong survival)

    • EMT marker expression in tumor tissues (immunohistochemical staining shows decreased vimentin and N-cadherin expression in TUBB2B-knockdown tumors)

    • Presence of TUBB2B-Vimentin complex in tumor tissues (demonstrated by immunofluorescence)

• Experimental design considerations:

  • Sample size calculation for statistical power

  • Randomization of animals to experimental groups

  • Blinded assessment of outcomes

  • Appropriate controls (non-targeting shRNA for knockdown studies)

  • Verification of TUBB2B modulation in vivo through immunohistochemistry

How can I address common challenges when using TUBB2B antibodies in immunofluorescence studies?

Immunofluorescence with TUBB2B antibodies can present specific challenges. Here are methodological solutions:

• High background signal:

  • Optimize blocking solution (5% BSA or normal serum matching secondary antibody species)

  • Increase washing steps (use at least 3 washes of 5 minutes each)

  • Dilute primary antibody appropriately (1/250-1/500 is recommended for most TUBB2B antibodies)

  • Use highly cross-adsorbed secondary antibodies

• Weak or no signal:

  • Optimize antigen retrieval method (heat-induced epitope retrieval is often effective)

  • Check antibody reactivity with your species of interest (confirmed reactivity with human and mouse)

  • Extend primary antibody incubation time (overnight at 4°C may improve signal)

  • Use signal amplification systems if necessary

• Non-specific binding:

  • Include negative controls (primary antibody omission and isotype controls)

  • Pre-absorb antibody with recombinant protein

  • Use TUBB2B-knockdown cells as specificity controls

• Co-localization studies with TUBB2B and Vimentin:

  • Select antibodies raised in different host species

  • Use appropriate filters to minimize spectral overlap

  • Apply proper co-localization analysis using specialized software

What are effective strategies for troubleshooting inconsistent results in TUBB2B Western blots?

Western blotting for TUBB2B may present technical challenges. Consider these methodological approaches:

• Sample preparation optimization:

  • Use lysis buffer containing protease inhibitors to prevent degradation

  • Maintain cold temperatures during extraction to preserve protein integrity

  • Determine optimal protein loading amount (typically 20-50 μg total protein)

• Gel separation considerations:

  • Use 10-12% acrylamide gels for optimal separation of TUBB2B (~50 kDa)

  • Include positive control samples (e.g., GBM cell lines like T98 or LN229 known to express high levels of TUBB2B)

• Transfer efficiency:

  • Optimize transfer conditions (voltage, time, buffer composition)

  • Verify transfer efficiency using reversible staining of membranes

• Antibody optimization:

  • Determine optimal antibody dilution through titration (starting with 1/250-1/500)

  • Extend primary antibody incubation (overnight at 4°C may improve signal)

  • Use appropriate secondary antibody (matching the isotype of the primary antibody, IgG2a for the AT5B3 clone)

• Signal detection:

  • Choose appropriate detection method based on expected expression level

  • For quantitative analysis, ensure signal is within linear range

• Normalization strategy:

  • Select appropriate loading controls (β-actin, GAPDH)

  • For cytoskeletal proteins like TUBB2B, consider alternative loading controls to avoid potential co-regulation

How should I approach data discrepancies when comparing TUBB2B expression across different experimental platforms?

When inconsistencies arise between different experimental methods measuring TUBB2B expression:

• Understand methodological differences:

  • Western blot: Measures denatured protein, good for total protein quantification

  • Immunofluorescence: Preserves cellular architecture, reveals localization

  • qRT-PCR: Measures mRNA levels, not protein

  • IHC: Tissue context, but potential artifacts from fixation and processing

• Standardization approaches:

  • Use the same antibody clone across platforms when possible (e.g., AT5B3 clone)

  • Include consistent positive and negative controls

  • Process all samples simultaneously to minimize batch effects

• Resolution strategies:

  • Validate with alternative antibodies targeting different epitopes

  • Employ TUBB2B knockdown or overexpression models as reference points

  • Consider post-translational modifications that may affect antibody binding

  • Assess mRNA-protein correlation for TUBB2B in your experimental system

• Data integration:

  • Weight evidence based on methodological strengths (e.g., prioritize quantitative western blot data for expression levels and IF/IHC for localization)

  • Report discrepancies transparently in publications

  • Consider biological explanations for discrepancies (e.g., subcellular localization changes)

How can I investigate the role of TUBB2B in drug resistance mechanisms in cancer?

TUBB2B's role in drug resistance, particularly for microtubule-targeting agents, presents an important research avenue:

• Expression correlation studies:

  • Compare TUBB2B expression levels between drug-sensitive and drug-resistant cell lines

  • Analyze patient samples before and after treatment failure

  • Correlate TUBB2B expression with clinical outcomes

• Functional studies:

  • Generate TUBB2B knockdown and overexpression models in cancer cell lines

  • Assess changes in drug sensitivity using:

    • MTT/MTS cell viability assays

    • Apoptosis assays (Annexin V/PI staining)

    • Cell cycle analysis

• Mechanism investigation:

  • Examine alterations in microtubule dynamics using live-cell imaging

  • Assess changes in EMT marker expression, as EMT has been linked to drug resistance

  • Investigate TUBB2B mutations that might affect drug binding sites

• Combination strategies:

  • Test TUBB2B inhibition in combination with standard chemotherapeutics

  • Explore synthetic lethality approaches

  • Develop TUBB2B-targeting strategies for overcoming resistance

What experimental approaches can explore the connection between TUBB2B's role in neuronal development and cancer?

TUBB2B functions in both neuronal development and cancer progression, suggesting shared molecular mechanisms:

• Comparative expression analysis:

  • Profile TUBB2B expression patterns in developing neurons versus cancer cells

  • Identify common transcriptional regulators

• Protein interaction networks:

  • Compare TUBB2B interaction partners in neuronal and cancer contexts using Co-IP followed by mass spectrometry

  • Focus on shared interactors like Vimentin, which plays roles in both neuronal development and EMT

• Migration mechanism comparison:

  • Assess whether TUBB2B regulates similar cytoskeletal rearrangements in neuronal migration and cancer cell invasion

  • Compare the effects of TUBB2B mutations (particularly the R391/K392/A393/F394 region) on neuronal development and cancer cell behavior

• Signaling pathway analysis:

  • Investigate whether TUBB2B engages similar signaling pathways in both contexts

  • Focus on pathways known to regulate both neurodevelopment and cancer (e.g., Wnt, Notch)

• Therapeutic implications:

  • Explore whether drugs that target TUBB2B-dependent processes in one context may be repurposed for the other

  • Consider developmental neurotoxicity when developing TUBB2B-targeting cancer therapies

What novel technologies might advance our understanding of TUBB2B function and regulation?

Several cutting-edge technologies hold promise for deeper insights into TUBB2B biology:

• Advanced imaging approaches:

  • Super-resolution microscopy to visualize TUBB2B in microtubule networks at nanoscale resolution

  • Live-cell imaging with fluorescently-tagged TUBB2B to study dynamics in real-time

  • Expansion microscopy to physically enlarge subcellular structures for better visualization

• CRISPR-based technologies:

  • CRISPR-Cas9 gene editing to create precise TUBB2B mutations

  • CRISPR interference/activation to modulate TUBB2B expression without genetic modification

  • CRISPR screens to identify synthetic lethal interactions with TUBB2B

• Single-cell approaches:

  • Single-cell RNA-seq to analyze TUBB2B expression heterogeneity

  • Single-cell proteomics to detect post-translational modifications

  • Spatial transcriptomics to visualize TUBB2B expression patterns in tissue context

• Structural biology:

  • Cryo-EM to resolve TUBB2B structure within microtubules

  • Hydrogen-deuterium exchange mass spectrometry to map dynamic protein interactions

  • AlphaFold2 and other AI-based structure prediction tools to model TUBB2B interactions

How might understanding TUBB2B function contribute to therapeutic developments?

TUBB2B research has several potential therapeutic applications:

• Cancer therapy approaches:

  • Targeting the TUBB2B-Vimentin interaction (particularly the R391/K392/A393/F394 region) to inhibit EMT and reduce GBM invasion

  • Developing drugs that selectively target cancer cells with TUBB2B overexpression

  • Using TUBB2B expression as a biomarker for treatment stratification

• Neurological disorder treatments:

  • Gene therapy approaches for TUBB2B-associated polymicrogyria

  • Small molecules that rescue function of specific TUBB2B mutations

  • Modulation of TUBB2B expression or function to enhance neuronal repair

• Delivery systems:

  • Nanoparticle-based delivery of TUBB2B-targeting agents to brain tumors

  • Blood-brain barrier penetrating strategies for TUBB2B modulators

• Combination therapy strategies:

  • Combining TUBB2B-targeting approaches with standard-of-care treatments

  • Exploiting synthetic lethality with TUBB2B inhibition