TWF1 Human

What is TWF1 and what is its primary function in human cells?

TWF1 (twinfilin actin binding protein 1) is a relatively conserved actin-binding protein that plays crucial roles in regulating cytoskeletal dynamics. Its activity helps cells adapt their shape and movement, facilitating diverse cellular functions and signaling processes . TWF1 primarily functions by binding to actin monomers and capping filament ends, thereby controlling actin polymerization and depolymerization processes that are fundamental to cell migration, division, and morphological changes.

At the molecular level, TWF1 contains actin-binding domains that allow it to interact with both monomeric and filamentous actin. The TWF1 protein sequence includes multiple functional domains, such as the ADF-H (actin-depolymerizing factor homology) domains, which are responsible for its interaction with actin cytoskeleton .

Which gene transcripts encode human TWF1?

Human TWF1 is encoded by multiple transcript variants, with the most commonly referenced Genbank sequences being NM_001242397.1 and NM_002822.4 . When designing experiments targeting TWF1, researchers should be aware of these different transcript variants to ensure comprehensive coverage. TWF1 is also known by alternative names including A6 and PTK9 in some databases and literature .

For researchers planning gene targeting experiments, it's important to note that TWF1 gRNA plasmids have been designed to target these specific reference sequences, which facilitates CRISPR-based genetic manipulation of TWF1 in experimental settings .

How can TWF1 expression be accurately measured in tissue samples?

Several methodological approaches can be employed to measure TWF1 expression:

• Western Blotting: For protein expression, tissue samples can be ground and treated with radioimmunoprecipitation assay (RIPA) lysis buffer to extract total protein. Following protein quantification using a bicinchoninic acid (BCA) assay, proteins can be separated by 10% SDS-PAGE and transferred to PVDF membranes. TWF1 can be detected using specific antibodies (e.g., Proteintech Cat No. 11732-1-AP) with appropriate secondary antibodies for visualization .

• Immunohistochemistry (IHC): This technique allows for visualization of TWF1 expression in tissue sections and enables comparison between tumor and adjacent normal tissues .

• RNA-seq Analysis: Transcriptome analysis using RNA-seq data from databases like TCGA can provide valuable information on TWF1 expression at the mRNA level. Data processing typically involves filtering, log2 transformation of TPM+1 values, and normalization .

When comparing expression levels, it's advisable to include paired samples (tumor tissue and adjacent normal tissue from the same patient) to reduce biological variability and strengthen statistical power of findings .

What are the common pitfalls in TWF1 protein detection experiments?

Common challenges in TWF1 protein detection include:

• Antibody Specificity: Ensuring antibody specificity is crucial, as cross-reactivity with related actin-binding proteins can confound results. Always validate antibodies using positive and negative controls before proceeding with experimental samples.

• Protein Extraction Efficiency: TWF1's interaction with the actin cytoskeleton may affect extraction efficiency using standard lysis buffers. Optimizing protein extraction protocols by adjusting detergent concentrations or including cytoskeleton-disrupting agents can improve detection.

• Sample Preservation: TWF1 protein stability during sample processing can affect detection sensitivity. Flash-freezing samples immediately after collection and maintaining a consistent cold chain during processing are recommended.

• Quantification Challenges: For accurate quantification, researchers should normalize TWF1 expression to appropriate housekeeping proteins and employ densitometric analysis tools that account for background signal variation.

How does TWF1 contribute to cancer progression mechanisms?

TWF1 has been identified as a potential pro-oncogene that advances cancer initiation and development across multiple cancer types . In lung adenocarcinoma (LUAD), TWF1 overexpression correlates with advanced tumor progression and poorer clinical outcomes.

The mechanisms through which TWF1 contributes to cancer progression include:

• Enhanced Cell Proliferation: Inhibition of TWF1 expression significantly reduces cancer cell proliferation, suggesting that TWF1 promotes cell cycle progression .

• Increased Cell Migration and Invasion: TWF1 affects the migratory and invasive capacity of cancer cells, potentially by regulating cytoskeletal dynamics required for cell movement .

• MMP1 Regulation: TWF1 appears to regulate the expression of matrix metalloproteinase 1 (MMP1), an enzyme involved in extracellular matrix degradation that facilitates tumor invasion and metastasis .

• Immune Microenvironment Modulation: TWF1 expression correlates with altered immune cell infiltration profiles, including changes in dendritic cells, macrophages, and various T cell populations .

Research in breast cancer has shown that TWF1 advances progression by modulating the expression of IL-11, cyclin D1, and c-Myc, while in pancreatic cancer, miR-142-3p inhibits cancer cell activities by targeting TWF1 .

What is the prognostic significance of TWF1 expression in lung adenocarcinoma?

TWF1 has significant prognostic value in lung adenocarcinoma (LUAD):

How does TWF1 expression affect the tumor immune microenvironment in LUAD?

TWF1 expression significantly impacts the tumor immune microenvironment in LUAD, with differential effects on various immune cell populations:

This complex pattern of immune cell infiltration suggests that TWF1 may influence tumor-immune interactions, potentially affecting immunosurveillance and response to immunotherapy . The analysis of immune infiltration scores was performed using the TIMER web application and TCGA database, providing quantitative assessment of 22 major immune cell types in the tumor microenvironment .

What is the relationship between TWF1 expression and sensitivity to anticancer drugs?

TWF1 expression levels correlate with differential sensitivity to various anticancer drugs:

• Specific Drug Associations: Analysis using the GDSC database revealed associations between TWF1 expression and sensitivity to multiple anticancer drugs, including A-770041, Bleomycin, and BEZ235 .

• Methodological Approach: This association was established by analyzing gene mutation data of cell lines and IC50 values of anticancer drugs using the R package "pRophetic" .

• Immunotherapy Response: TWF1 expression correlates with LUAD-associated immune scores, particularly for immune checkpoint molecules like PD1 and CTLA4, suggesting potential implications for immunotherapy efficacy .

• Tumor Mutation Burden: TWF1 expression shows correlation with tumor mutation burden (TMB), which is a known predictor of response to immune checkpoint inhibitors .

These findings suggest that TWF1 expression status might serve as a biomarker for predicting treatment responses, potentially guiding personalized therapy selection for LUAD patients.

What CRISPR-based approaches are available for targeting TWF1 in human cells?

For researchers interested in manipulating TWF1 expression using CRISPR technology, several tools and methodologies are available:

• gRNA Plasmids: TWF1-targeting gRNA plasmids such as BRDN0001147784 (Plasmid #77288) are available for CRISPR applications. These third-generation lentiviral gRNA plasmids are designed to target specific Genbank reference sequences (NM_001242397.1, NM_002822.4) .

• Complementary Cas9 Expression: Since the gRNA plasmids do not contain Cas9, they should be used in conjunction with lentiCas9-Blast (Addgene #52962) or with cell lines already expressing Cas9 .

• Selection Markers: These plasmids typically contain puromycin resistance markers for selection of successfully transduced cells .

• Vector Backbone: The lentiGuide-Puro backbone allows for efficient delivery via lentiviral transduction, particularly useful for difficult-to-transfect cell types .

• gRNA Sequence: The specific gRNA sequence (CTGAAGAAGGAATTTGGAGG) has been designed to target human TWF1 effectively .

When implementing CRISPR-based TWF1 targeting, researchers should verify successful gene editing through appropriate validation methods such as sequencing, Western blotting, or functional assays to confirm the phenotypic consequences of TWF1 knockdown.

How can recombinant TWF1 protein be effectively used in in vitro experimental systems?

Recombinant TWF1 protein provides a valuable tool for various in vitro applications:

• Available Formats: Recombinant Human TWF1/Twinfilin-1 protein is available as a human fragment protein in the 100 to 350 amino acid range, expressed in Escherichia coli with >80% purity .

• Protein Characteristics: These recombinant proteins typically contain tags such as His-tags (MGSSHHHHHHSSGLVPRGSHM) for purification and detection purposes .

• Applications:

  • Actin Polymerization Assays: Recombinant TWF1 can be used to study its effects on actin dynamics in reconstituted systems.

  • Protein-Protein Interaction Studies: Pull-down assays, co-immunoprecipitation, or surface plasmon resonance can be employed to identify TWF1 binding partners.

  • Antibody Validation: As positive controls in Western blotting or immunohistochemistry experiments.

  • Functional Recovery Experiments: Supplementing TWF1-depleted systems with recombinant protein to assess functional rescue.

• Storage and Handling: Proper storage conditions (typically -80°C for long-term storage, with aliquoting to avoid freeze-thaw cycles) and handling procedures should be followed to maintain protein activity.

When designing experiments with recombinant TWF1, researchers should consider potential differences between recombinant proteins and endogenously expressed TWF1, particularly regarding post-translational modifications that might affect function.

How does TWF1 influence immune checkpoint inhibitor therapy response?

The relationship between TWF1 expression and response to immune checkpoint inhibitor therapy is complex:

• Immune Score Correlation: TWF1 expression shows significant correlation with LUAD-associated immune scores, particularly for immune checkpoint molecules like PD1 and CTLA4 .

• Methodological Analysis: This correlation was established by analyzing immune score data obtained from The Cancer Imaging Archive (TCIA) database and correlating it with TWF1 expression levels .

• Immune Cell Infiltration: TWF1 expression is associated with altered patterns of immune cell infiltration, including T cell populations that are critical for response to immune checkpoint inhibitors .

• TMB Association: TWF1 expression correlates with tumor mutation burden (TMB), which is a established predictor of response to immune checkpoint inhibitors - higher TMB generally predicts better response .

These findings suggest that TWF1 expression status might serve as a biomarker for predicting immunotherapy response. Researchers investigating this relationship should consider incorporating TWF1 expression analysis in their study designs when evaluating immune checkpoint inhibitor efficacy.

What mechanisms underlie the correlation between TWF1 and specific immune cell populations?

Several potential mechanisms may explain the relationship between TWF1 and immune cell population dynamics:

• Cytoskeletal Regulation in Immune Cells: As an actin-binding protein, TWF1 may directly affect the cytoskeletal dynamics in immune cells, influencing their migration, activation, and effector functions.

• Inflammatory Signaling: TWF1 may modulate the production of inflammatory cytokines that regulate the recruitment and activation of specific immune cell populations. In breast cancer, TWF1 has been shown to modulate IL-11 expression , suggesting similar mechanisms might operate in lung cancer.

• Cancer Cell-Immune Cell Interactions: TWF1-mediated changes in cancer cell surface receptor expression or extracellular matrix composition may alter the interactions between tumor cells and immune cells, affecting immune cell infiltration patterns.

• Metabolic Reprogramming: Changes in TWF1 expression might affect cellular metabolism, creating a tumor microenvironment that differentially supports specific immune cell subtypes.

For researchers investigating these mechanisms, experimental approaches might include co-culture systems of TWF1-manipulated cancer cells with various immune cell populations, analysis of cytokine/chemokine production, and in vivo studies using immunocompetent mouse models with TWF1 modulation.

How can researchers address variability in TWF1 expression analysis across different samples?

Variability in TWF1 expression analysis is a common challenge. Researchers can implement several strategies to address this issue:

• Standardized Sample Collection: Establish consistent protocols for sample collection, processing, and storage to minimize pre-analytical variables. For tissue samples, factors such as ischemia time, fixation methods, and storage conditions should be standardized.

• Paired Sampling Design: When possible, use paired samples (tumor and adjacent normal tissue from the same patient) to control for individual variability. This approach significantly strengthens statistical power, as demonstrated in studies showing TWF1 upregulation in paired LUAD tissues .

• Multiple Detection Methods: Employ complementary techniques (e.g., qPCR, Western blotting, IHC) to cross-validate expression findings. This multi-modal approach helps confirm whether observed variations reflect true biological differences or method-specific artifacts.

• Reference Gene Selection: For qPCR and Western blotting, carefully select appropriate reference genes or proteins that show minimal variation across the sample set. Multiple reference controls may be necessary depending on the experimental context.

• Statistical Handling of Outliers: Implement robust statistical methods for identifying and addressing outliers, and consider larger sample sizes to accommodate natural biological variation.

What are the key considerations when interpreting conflicting results between in vitro and in vivo TWF1 studies?

Discrepancies between in vitro and in vivo TWF1 studies are not uncommon and require careful interpretation:

• Microenvironmental Complexity: In vivo systems incorporate complex tumor microenvironments including stromal cells, immune components, and extracellular matrix that may influence TWF1 function in ways not replicated in vitro. Consider whether the observed differences might reflect these microenvironmental interactions.

• Temporal Dynamics: In vitro studies typically examine acute responses over short timeframes, while in vivo studies may capture longer-term adaptations. Temporal considerations should inform experimental design and interpretation of seemingly conflicting results.

• Model-Specific Considerations:

  • Cell line selection for in vitro studies may not fully represent the heterogeneity of primary tumors.

  • Animal models may have species-specific differences in TWF1 function or regulatory networks.

  • Patient-derived xenograft models, while more representative, lack functional immune components.

• Context-Dependent TWF1 Functions: TWF1 may exhibit different functions depending on cellular context, activation state, or expression level. Context-specific roles should be considered when reconciling conflicting findings.

• Validation Approaches: To address discrepancies, consider:

  • Using multiple cell lines or primary cultures to establish generalizability of in vitro findings

  • Implementing complementary in vivo models (genetic, xenograft, orthotopic) to validate key findings

  • Confirming results in human clinical samples whenever possible