UBE2L6 Human

What is UBE2L6 and what is its primary function in human cells?

UBE2L6 is an E2 conjugating enzyme that functions in both the ubiquitination and ISGylation pathways. It plays a critical role in facilitating the conjugation of ISG15 (interferon-stimulated gene 15) to target proteins, a process known as ISGylation. This post-translational modification is similar to ubiquitination but serves distinct biological functions, particularly in immune responses.

Methodologically, researchers typically characterize UBE2L6 function through biochemical assays that monitor its conjugation activity. These include in vitro ISGylation assays using recombinant proteins, co-immunoprecipitation studies to identify binding partners, and mass spectrometry approaches to identify ISGylated target proteins. Additionally, mutational analyses of the catalytic cysteine residue can help distinguish between enzymatic and scaffolding functions of UBE2L6 .

How is UBE2L6 expression regulated in human cells?

UBE2L6 expression is strongly regulated by type I interferons, positioning it as part of the interferon-stimulated gene (ISG) family. Research has shown that UBE2L6 may be upregulated by type I interferon signaling pathways, which was confirmed experimentally in multiple studies .

To investigate UBE2L6 regulation, researchers typically employ qPCR to measure transcript levels following various stimuli. For instance, in studies of Mtb-infected THP-1 cells, UBE2L6 showed significant upregulation (logFC value of 2.3163, p-value of 7.04E-07) . Expression analysis in different cell types reveals that UBE2L6 levels vary significantly between normal and disease states, with particularly notable differences between immature and differentiated blood cells .

What is the relationship between UBE2L6 and the ISGylation pathway?

UBE2L6 functions as the primary E2 conjugating enzyme in the ISGylation cascade, working in concert with UBE1L (E1 activating enzyme) and various E3 ligases, particularly HERC5. The ISGylation pathway involves a sequential enzymatic process:

• Activation of ISG15 by UBE1L (E1)

• Transfer of ISG15 to UBE2L6 (E2)

• Conjugation of ISG15 to target proteins with the help of E3 ligases like HERC5

Experimental approaches to study this pathway include knockdown/knockout studies of pathway components, immunoblotting for free and conjugated ISG15, and proteomic analyses to identify ISGylated proteins. Research has demonstrated that UBE2L6 depletion significantly attenuates ISG15 conjugation, confirming its essential role in this process .

How does UBE2L6 contribute to obesity-related inflammation and insulin resistance?

UBE2L6 promotes M1 macrophage polarization in high-fat diet (HFD)-induced obesity, thereby contributing to adipose tissue inflammation and insulin resistance. Mechanistically, UBE2L6 enhances the expression and activation of Signal Transducer and Activator of Transcription 1 (STAT1) through ISG15-mediated ISGylation, which drives the pro-inflammatory M1 macrophage phenotype .

Researchers investigating this phenomenon typically employ animal models of diet-induced obesity, comparing wild-type mice with those having macrophage-specific Ube2L6 knockout (Ube2L6AKO). Methodologies include:

• Flow cytometry to assess macrophage polarization markers

• RT-qPCR to quantify expression of M1/M2-associated genes

• Western blotting to analyze STAT1 phosphorylation and protein levels

• Co-immunoprecipitation assays to detect ISGylated STAT1

• ELISA to measure pro-inflammatory cytokine production

These approaches reveal that Ube2L6 deletion restrains the polarization of pro-inflammatory M1 macrophages and macrophage infiltration in adipose tissue of HFD-fed mice, suggesting UBE2L6 as a potential therapeutic target for obesity-related metabolic disorders .

What role does UBE2L6 play in leukemic cell differentiation?

UBE2L6 appears to be critical for all-trans retinoic acid (ATRA)-induced differentiation of acute promyelocytic leukemia (APL) cells. Studies have shown that ATRA strongly induces UBE2L6 expression in ATRA-sensitive leukemia cells (NB4 APL and HL60 AML cells), with up to 180-fold increase in expression observed after treatment .

Methodologically, researchers investigate this phenomenon through:

• shRNA-mediated knockdown of UBE2L6 in leukemia cell lines

• Assessment of differentiation markers following ATRA treatment

• Measurement of ISG15 and ISGylated proteins

• Analysis of cell morphology and functional assays for granulocytic differentiation

Research has demonstrated that UBE2L6 depletion impedes ATRA-mediated differentiation, suggesting its functional importance in this process. The mechanism appears to involve UBE2L6-dependent ISGylation, as knockdown of ISG15 similarly attenuates differentiation .

Can UBE2L6 serve as a biomarker for tuberculosis infection?

UBE2L6 has shown significant potential as a biomarker for tuberculosis (TB). ROC analysis from multiple datasets revealed high diagnostic efficiency with AUC values of 0.931 (sensitivity 87.5%, specificity 88.9%) and 0.981 (sensitivity 100%, specificity 93.8%) in distinguishing TB patients from healthy controls .

Researchers evaluate biomarker potential through:

• Analysis of gene expression in peripheral blood samples from TB patients versus healthy controls

• ROC curve analysis to determine sensitivity and specificity

• Differential expression analysis across various disease states (pulmonary TB, extra-pulmonary TB, sarcoidosis)

• Validation across independent datasets

While UBE2L6 shows excellent performance in distinguishing healthy individuals from those with pulmonary TB (AUC: 0.985, 97.8% sensitivity, 95.1% specificity), its ability to differentiate between different forms of TB or between TB and other granulomatous diseases like sarcoidosis is more limited .

What are the most effective methods for studying UBE2L6 expression and function?

Researchers employ multiple complementary approaches to study UBE2L6:

• Gene expression analysis:

  • RT-qPCR with specific primers (e.g., UBE2L6_F CTGGAAGCCTTGCACCAAGA, UBE2L6_R GAACATGAGTTAGGAGGGCCG)

  • RNA sequencing to capture expression changes in various conditions

  • TaqMan arrays for comparative expression studies across tissues

• Protein analysis:

  • Western blotting to detect UBE2L6 protein levels

  • Immunohistochemistry to visualize tissue distribution

  • Co-immunoprecipitation to identify interaction partners

• Functional studies:

  • shRNA or CRISPR-based knockdown/knockout systems

  • Overexpression studies with wild-type and mutant constructs

  • In vitro enzymatic assays to measure ISGylation activity

• Cellular phenotype assessment:

  • Flow cytometry for cell surface markers (e.g., in macrophage polarization studies)

  • Cell differentiation assays (morphology, function, marker expression)

  • Cytokine production measurements (ELISA, multiplex assays)

How can researchers effectively manipulate UBE2L6 levels in experimental systems?

Several approaches have been successfully employed to modulate UBE2L6 expression:

• Genetic knockdown/knockout strategies:

  • shRNA-mediated depletion in cell lines (successfully used in NB4 APL cells)

  • CRISPR-Cas9 gene editing for complete knockout

  • Tissue-specific knockout in animal models (e.g., Ube2L6AKO mice with macrophage-specific deletion)

• Induction approaches:

  • Treatment with type I interferons to upregulate endogenous UBE2L6

  • ATRA treatment in appropriate cell systems (e.g., 180-fold induction in NB4 cells)

• Overexpression systems:

  • Transient transfection with UBE2L6 expression vectors

  • Stable cell lines with inducible UBE2L6 expression

  • Viral vector-mediated delivery for hard-to-transfect cells

Each approach has advantages for specific research questions. For mechanistic studies, combinations of knockdown with rescue experiments using wildtype or catalytically inactive mutants can provide robust evidence for UBE2L6's enzymatic function versus potential scaffolding roles .

What techniques are available for identifying UBE2L6 substrates and interaction partners?

Researchers employ multiple complementary approaches to identify UBE2L6 substrates and interactors:

• Proteomic approaches:

  • Immunoprecipitation followed by mass spectrometry

  • SILAC or TMT labeling to quantify differential ISGylation

  • Proximity labeling techniques (BioID, APEX) to identify spatial interactors

• Biochemical methods:

  • Co-immunoprecipitation assays (successfully used to demonstrate UBE2L6-STAT1 interaction)

  • In vitro ISGylation assays with recombinant proteins

  • Yeast two-hybrid screening for binary interactions

• Computational predictions:

  • Structural modeling of UBE2L6-substrate interfaces

  • Sequence analysis for ISGylation motifs

  • Integration of expression correlation data

• Genetic correlation studies:

  • Comparison of phenotypes between UBE2L6 and potential substrate knockdowns

  • Genetic interaction mapping (e.g., synthetic lethality screens)

One successful application involved identifying STAT1 as a UBE2L6-dependent ISGylation target in macrophages, with functional consequences for M1 polarization. The researchers used co-immunoprecipitation assays to validate this protein interaction .

What are the molecular mechanisms by which UBE2L6-mediated ISGylation affects protein function?

UBE2L6-mediated ISGylation can modify protein function through several mechanisms:

• Alteration of protein stability:

  • ISGylation may compete with ubiquitination, potentially protecting proteins from degradation

  • Alternatively, it may promote degradation through specific recognition by ISG15-specific proteases

• Modulation of protein activity:

  • Direct effects on enzymatic activity or DNA binding capacity

  • Allosteric regulation through conformational changes

• Alteration of protein-protein interactions:

  • Creation of new interaction surfaces

  • Blocking existing interaction domains

• Changes in subcellular localization:

  • Addition of ISG15 may expose or mask localization signals

  • Creation of new targeting motifs

In the context of STAT1 regulation, research shows that UBE2L6 promotes STAT1 expression and activation through ISG15-mediated ISGylation, enhancing its transcriptional activity and driving M1 macrophage polarization. This represents a clear example of how ISGylation can amplify signaling pathway activity .

Methodologically, researchers investigate these mechanisms through site-directed mutagenesis of target lysine residues, domain deletion experiments, and cellular localization studies using fluorescently tagged proteins.

How does UBE2L6 differ functionally from other E2 enzymes in the ubiquitin-like protein conjugation pathways?

UBE2L6 exhibits several distinctive features compared to other E2 enzymes:

• Dual functionality:

  • UBE2L6 can function in both ubiquitination and ISGylation pathways

  • Most E2 enzymes are specific to a single UBL pathway

• E3 ligase interactions:

  • Works with specific E3 ligases like HERC5 for ISGylation

  • May interact with a different subset of E3s for ubiquitination

• Regulation patterns:

  • Strongly induced by type I interferons

  • Expression patterns differ significantly from other E2s

• Substrate specificity:

  • Contributes to the selection of ISGylation targets

  • May have unique recognition features for substrate selection

This table, based on data from studies of ATRA-induced differentiation, highlights the coordinated upregulation of the entire ISGylation machinery, with UBE2L6 showing the most dramatic increase .

What is the potential of UBE2L6 as a therapeutic target in different disease contexts?

UBE2L6 shows promise as a therapeutic target in several disease contexts:

• Metabolic disorders:

  • Targeting UBE2L6 could potentially reduce obesity-associated inflammation

  • Inhibition may help reprogram macrophages from M1 to M2 phenotypes

  • Research in Ube2L6AKO mice showed that Ube2L6 deficiency restrains M1 macrophage polarization and infiltration in high-fat diet conditions

• Hematological malignancies:

  • UBE2L6 appears essential for ATRA-induced differentiation of APL cells

  • Enhancing UBE2L6 activity might improve differentiation therapy responses

  • Expression is reduced in primary AML cells compared to normal mature granulocytes

• Infectious diseases:

  • UBE2L6's role in the interferon response makes it relevant for infectious disease management

  • High diagnostic value as a TB biomarker suggests its involvement in antimycobacterial immunity

  • Manipulation might enhance host defense mechanisms

Methodologically, researchers evaluate therapeutic potential through:

• Genetic deletion studies in disease models

• Small molecule inhibitor screening and development

• Analysis of expression correlation with disease outcomes

• Pathway intervention studies targeting upstream regulators

While targeting E2 enzymes presents challenges due to their central role in multiple pathways, the relative specificity of UBE2L6 for ISGylation (compared to ubiquitination) may offer a therapeutic window for selective intervention.

How does UBE2L6 contribute to the interferon response beyond ISGylation?

UBE2L6's role in interferon responses likely extends beyond its enzymatic function in ISGylation. Research suggests it may participate in:

• Regulation of interferon-stimulated gene expression:

  • Potential feedback mechanisms affecting IFN signaling

  • ISGylation of transcription factors or chromatin modifiers

• Cross-talk with other post-translational modification systems:

  • Competition or cooperation with ubiquitination pathways

  • Influence on SUMOylation or other UBL modifications

• Viral antagonism mechanisms:

  • Many viruses target ISGylation to evade immune responses

  • UBE2L6 may be directly targeted by viral immune evasion proteins

Functional studies in Mtb-infected THP-1 cells reveal UBE2L6's importance in cytokine production (p=1.33E-12) and type I interferon production (p=5.18E-06), suggesting broader roles in immune regulation beyond its enzymatic function in protein modification .

What are the structural mechanisms underlying UBA7- UBE2L6 disulfide formation?

Recent research is investigating disulfide formation between UBA7 (UBE1L) and UBE2L6, which may represent an important regulatory mechanism for ISGylation. While the detailed structural mechanisms weren't fully elaborated in the available search results, this area represents an emerging direction in UBE2L6 research .

Typical methodological approaches for such studies include:

• Structural biology techniques:

  • X-ray crystallography of the UBA7-UBE2L6 complex

  • Cryo-EM to visualize larger assemblies

  • NMR for dynamic interactions

• Biochemical validation:

  • Site-directed mutagenesis of relevant cysteine residues

  • Redox-dependent activity assays

  • Mass spectrometry to map disulfide bonds

• Cellular studies:

  • Analysis of complex formation under oxidative stress

  • Effects of redox-modulating agents on ISGylation

Understanding this mechanism could provide insights into how ISGylation is regulated in response to cellular stress and may reveal new opportunities for therapeutic intervention.