dgkA Antibody

What is DGKA and why is it important in research?

DGKA (diacylglycerol kinase alpha) is an enzyme that converts diacylglycerol (DAG) into phosphatidic acid (PA), acting as a central regulatory switch between different signaling pathways. Its significance stems from its role in modulating these two bioactive lipids with distinct cellular targets and often opposite effects in numerous biological processes . DGKA plays important roles in T-cell function, cancer progression, and resistance to immunotherapy. Research indicates it's aberrantly elevated in several cancer types including lung cancer, with high expression correlating with poor prognosis . DGKA also mediates resistance to PD-1 blockade in cancer immunotherapy by exacerbating the exhaustion of reinvigorated tumor-specific T cells . Its dual role in both immune cells and cancer cells makes it an important research target for understanding disease mechanisms and developing potential therapeutic approaches.

What applications can DGKA antibodies be used for in research?

DGKA antibodies have demonstrated utility across multiple experimental applications:

Each application requires specific optimization based on sample type and experimental conditions . DGKA antibodies have been used extensively in cancer research, immunology studies, and investigations of signaling pathways, with multiple published studies validating their use in these contexts .

How should I choose between different DGKA antibody clones?

When selecting a DGKA antibody, consider several key factors that impact experimental success. First, determine your application needs—different antibodies perform optimally in specific applications like WB, IHC, or FC. Review validation data for your specific application and cell/tissue type, as reactivity can vary between human, mouse, and rat samples . Consider antibody format (polyclonal vs. monoclonal)—polyclonals often provide higher sensitivity but potentially lower specificity, while monoclonals offer consistent reproducibility. Examine the immunogen sequence to ensure it targets your region of interest; for instance, some DGKA antibodies are raised against the 100-350 amino acid region while others target the 300-400 region . For functional studies, antibodies validated in knockout/knockdown systems provide highest confidence. Published literature citing specific antibody catalog numbers offers valuable insights into real-world performance across applications. Many researchers use antibodies from established vendors (e.g., Proteintech 11547-1-AP) that have extensive validation data and citation records to ensure experimental reliability .

What are the optimal conditions for Western blot detection of DGKA?

For optimal Western blot detection of DGKA, preparation is key. First, prepare protein lysates from appropriate positive control samples (Jurkat, HeLa, or MOLT-4 cells are recommended) . DGKA has an observed molecular weight of approximately 83 kDa, so use gel percentages appropriate for this size (typically 8-10% polyacrylamide). For protein transfer, standard wet or semi-dry systems with PVDF membranes yield good results. When blocking, 5% BSA in TBST typically performs better than milk-based blockers for phosphoprotein studies. The recommended antibody dilution ranges from 1:2000 to 1:12000, but optimization is advised starting at 1:4000 for initial trials . Overnight primary antibody incubation at 4°C generally produces cleaner results than shorter incubations at room temperature. For detection, both chemiluminescence and fluorescence-based systems work well, with the latter providing better quantification capabilities. When troubleshooting weak signals, extending exposure time, increasing antibody concentration, or using enhanced detection systems can help. For high background issues, more stringent washing steps (additional washes with higher TBST concentrations) and further antibody dilution are recommended. Loading controls should be selected based on experimental context, with β-actin or GAPDH suitable for most applications involving DGKA detection .

What are the key considerations for flow cytometry using DGKA antibodies?

Flow cytometry with DGKA antibodies requires careful attention to protocol details for successful intracellular staining. Begin with proper fixation and permeabilization—since DGKA is an intracellular target, standard surface staining protocols will not suffice. Most researchers use formaldehyde-based fixatives (2-4%) followed by permeabilization with either saponin-based or methanol-based buffers, with the latter often providing better access to intracellular kinases. The recommended antibody concentration is 0.40 μg per 10^6 cells in a 100 μl suspension . Always include appropriate controls: isotype controls at the same concentration as the primary antibody, unstained cells, and ideally, DGKA-knockout or knockdown samples as negative controls . For multi-parameter experiments, carefully select fluorochromes to minimize spectral overlap. When analyzing T cells, which are significant in DGKA studies, consider including markers like CD3, CD8, and exhaustion markers (PD-1, TIM-3) to correlate DGKA expression with functional states . Optimization may require titration of antibody concentrations and adjustment of permeabilization conditions. For samples with expected low DGKA expression, signal amplification systems or brighter fluorochromes may improve detection sensitivity. Gating strategies should account for autofluorescence and include strict singlet gating. When analyzing results, median fluorescence intensity (MFI) often provides more reliable quantification than percentage positive cells for intracellular targets like DGKA .

What methodologies are used to assess DGKA's role in tumor growth and metastasis?

Researchers employ a comprehensive array of techniques to evaluate DGKA's impact on tumor growth and metastasis. In vitro approaches include proliferation assays (such as MTT, BrdU incorporation, or real-time cell analysis) to measure growth kinetics after DGKA manipulation. Cell migration and invasion assays (wound healing, transwell, and matrix-coated transwell systems) have demonstrated that DGKA inhibition reduces migration in endometrial cancer cells and invasion in breast cancer cells . Colony formation assays assess long-term proliferative potential, while apoptosis assays (TUNEL, Annexin V) have shown DGKA inhibits TNF-α-induced apoptosis in melanoma . For in vivo assessment, xenograft mouse models using DGKA-manipulated cancer cells have been instrumental in confirming in vitro findings. These models can involve subcutaneous or intravenous administration of tumor cells to study primary tumor growth or metastatic potential, respectively . Researchers have compared tumor control in DGKα−/− and DGKζ−/− mice, finding DGKζ plays a more significant role in limiting MC38 tumor growth, with effects that appear additive when combined with anti-PD1 treatment . For mechanistic investigations, Western blotting for pathway components (such as pERK, ERK) helps elucidate DGKA's downstream effects . Modern approaches include CRISPR-Cas9 gene editing to create knockout models for functional studies . In lung cancer research specifically, DGKA was found to promote tumorigenesis by regulating CCND3 expression, and the DGKA inhibitor ritanserin showed efficacy in suppressing tumor growth both in vitro and in vivo without evident toxic effects .

How do DGKA-targeting strategies impact cancer treatment outcomes?

DGKA-targeting approaches have demonstrated promising impacts on cancer treatment outcomes across multiple experimental models. Pharmacological inhibition of DGKA has shown therapeutic potential, with the DGKA inhibitor ritanserin effectively suppressing lung cancer growth both in vitro and in vivo without evident toxic effects . This suggests DGKA inhibitors could be developed as novel anticancer agents with favorable safety profiles. In combination therapy contexts, DGKA inhibition enhances the efficacy of existing treatments. For instance, pharmacologic ablation of DGKA postponed T-cell exhaustion and delayed development of resistance to PD-1 blockade, enhancing immunotherapy efficacy . This finding is particularly significant given the high rates of resistance to checkpoint inhibitor therapies in clinical settings. DGKA targeting can also overcome specific resistance mechanisms. Li et al. demonstrated that DGKA is involved in cisplatin resistance in ovarian cancer, with DGKA inhibition potentially resensitizing resistant cells to chemotherapy . The dual impact of DGKA—both on cancer cells directly and on the immune microenvironment—makes it an especially attractive therapeutic target. By simultaneously inhibiting tumor growth and enhancing anti-tumor immune responses, DGKA inhibition represents a potential "two-pronged" approach to cancer therapy . Looking forward, development of selective DGKA inhibitors with optimized pharmacokinetic properties could provide new treatment options for cancers with elevated DGKA expression, particularly those with poor prognosis like lung adenocarcinoma .

How does DGKA modulate T-cell function and immunotherapy response?

DGKA plays a crucial role in T-cell function through its regulation of DAG-mediated signaling pathways. Research has revealed that DGKA mediates T-cell dysfunction during anti-PD-1 therapy by exacerbating the exhaustion of reinvigorated tumor-specific T cells . This represents a significant T cell-intrinsic mechanism of resistance to immunotherapy. Mechanistically, DGKA terminates DAG-mediated activation of Ras and PKCθ pathways in T cells, thereby limiting their activation and effector functions . Pharmacologic inhibition of DGKA has been shown to postpone T-cell exhaustion and delay development of resistance to PD-1 blockade . These findings suggest that DGKA functions as a negative regulator of T-cell responses in the tumor microenvironment. Comparative studies between DGKα−/− and DGKζ−/− mice have demonstrated that while both isoforms regulate T-cell functions, DGKζ exerts greater control over CD8+ T cell activity and subsequent antitumor immunity . Specifically, DGKζ−/− mice showed superior control of tumor growth in an MC38 tumor model compared to DGKα−/− or wildtype mice . This differential impact suggests isoform-specific roles in T-cell regulation. The importance of DGKA in immune function is further emphasized by its selective targeting in combination immunotherapy approaches. Combining DGKA inhibition with anti-PD-1 therapy enhances therapeutic efficacy, suggesting a potential strategy to overcome resistance to checkpoint inhibitors . These findings collectively establish DGKA as an important immunomodulatory target with significant implications for improving cancer immunotherapy outcomes.

What techniques are used to study DGKA's impact on immune cell signaling?

Researchers employ diverse techniques to investigate DGKA's influence on immune cell signaling pathways. CRISPR-Cas9 gene editing has emerged as a powerful approach to evaluate DGKA function in primary human T cells. As demonstrated in the research data, scientists have successfully electroporated Cas9 and guide RNA complexes targeting DGKA into CD8+ T cells isolated from whole blood, achieving high editing efficiency (75-76% indel events) . This genetic manipulation allows for precise assessment of DGKA's role in T cell signaling and function. Western blotting for downstream signaling components like phosphorylated ERK (pERK) and total ERK provides direct evidence of DGKA's impact on MAPK pathway activation . Immunoprecipitation experiments using DGKA antibodies help identify protein-protein interactions that mediate its signaling effects. T cell activation and functional assays, including proliferation assays, cytokine production measurements, and cytotoxicity assays, quantify the functional consequences of DGKA manipulation. Flow cytometry with phospho-specific antibodies enables single-cell analysis of signaling events in heterogeneous immune populations. In vivo tumor models comparing wildtype, DGKα−/−, and DGKζ−/− mice provide systems-level insights into how DGKA modulates antitumor immunity . These models have revealed that DGKζ plays a more significant role in limiting tumor growth than DGKα . Adoptive transfer experiments with DGKA-manipulated T cells allow tracking of their fate and function in vivo. Additionally, phospholipid analysis techniques measure changes in DAG and PA levels resulting from DGKA activity, directly linking its enzymatic function to signaling outcomes. These methodological approaches collectively enable comprehensive analysis of how DGKA regulates immune cell signaling in both physiological and pathological contexts.

How can DGKA knockdown be effectively achieved in primary human cells?

CRISPR-Cas9 gene editing has emerged as the most effective approach for DGKA knockdown in primary human cells. The research data demonstrates successful implementation of this technique in CD8+ T cells isolated from human blood . The protocol involves isolation of CD8+ T cells using a RosetteSep CD8 cell kit (StemCell), followed by stimulation with CD3/CD28 dynabeads (Invitrogen) at a 1:1 ratio for 24 hours . After stimulation, cells are washed and beads removed before electroporation. The critical step involves mixing activated T cells with guide RNA (gRNA) and Cas9 protein complex, followed by electroporation using a 4D-Nucleofector system (Lonza) . Two effective gRNA sequences targeting DGKA have been validated: DGKA gRNA1 (TGATGTCCTAAAGCTCTTCG) and DGKA gRNA2 (TTATAGGCCATTGGGTACGA), achieving 76% and 75% indel frequencies, respectively . Post-electroporation, T cells are cultured in T cell media supplemented with 10 ng/ml of rHIL2 (Peprotech) . Knockdown efficiency should be validated at the protein level using Western blotting with anti-DGKA antibodies (such as those from Santa Cruz) . When comparing this approach to alternatives, CRISPR-Cas9 offers advantages over siRNA or shRNA methods, particularly for primary cells with limited lifespan. For functional studies, researchers should include appropriate controls, including non-targeting gRNAs and, when possible, rescue experiments with DGKA re-expression. This approach has been successfully used to evaluate changes in human CAR T cells lacking DGKs, demonstrating its utility in translational research contexts . The high editing efficiency achieved with this protocol makes it suitable for investigating DGKA's role in primary immune cell function without the limitations associated with transformed cell lines that often have genetic defects in critical signaling regulators .

What are the most promising approaches for developing and validating DGKA inhibitors for research and therapeutic applications?

Development and validation of DGKA inhibitors follow a systematic pipeline combining computational, biochemical, and biological approaches. Initial discovery can employ structure-based virtual screening targeting DGKA's catalytic domain, or high-throughput biochemical assays using recombinant DGKA protein to identify compounds that inhibit its kinase activity. Ritanserin has been identified as a promising DGKA inhibitor, showing efficacy in suppressing lung cancer growth both in vitro and in vivo without evident toxic effects . In vitro validation typically begins with enzyme inhibition assays measuring DGKA activity through quantification of phosphatidic acid production or ATP consumption. Cell-based assays then assess a compound's ability to modulate DGKA-dependent signaling, typically measuring DAG/PA levels or downstream pathway activation (ERK phosphorylation) . Target specificity must be thoroughly evaluated, comparing inhibition of DGKA versus other DGK isoforms and unrelated kinases. Medicinal chemistry optimization improves potency, selectivity, and pharmacokinetic properties of lead compounds. For pharmacological characterization, researchers should determine IC50 values, binding kinetics, and membrane permeability. In vivo validation includes pharmacokinetic/pharmacodynamic studies and efficacy testing in disease models. For cancer applications, xenograft models using DGKA-overexpressing tumors have demonstrated the therapeutic potential of DGKA inhibition . In immunotherapy contexts, combining DGKA inhibitors with checkpoint blockers (anti-PD-1) has shown enhanced efficacy by postponing T-cell exhaustion and delaying resistance development . The dual impact of DGKA inhibition—directly on cancer cells and on immune cell function—makes this approach particularly promising for cancer therapy. Studies have shown DGKA inhibition impairs lung tumorigenesis by suppressing cyclin D3 expression, suggesting specific mechanisms that can be monitored to assess inhibitor efficacy .

How can researchers troubleshoot non-specific binding issues with DGKA antibodies?

Addressing non-specific binding with DGKA antibodies requires systematic troubleshooting approaches. First, validate antibody specificity using positive and negative controls—Jurkat cells serve as reliable positive controls for DGKA expression, while DGKA knockout or knockdown samples provide definitive negative controls . For Western blotting, optimize blocking conditions; while 5% milk in TBST is standard, BSA-based blockers may reduce background for phospho-specific applications. Titrate antibody concentration starting from the manufacturer's recommendation (1:2000-1:12000 for WB, 1:50-1:500 for IHC/IF) , and increase the number and duration of wash steps between antibody incubations. For immunohistochemistry, optimize antigen retrieval conditions—TE buffer pH 9.0 is recommended for DGKA detection, with citrate buffer pH 6.0 as an alternative . Pre-adsorption of the antibody with the immunizing peptide can help identify non-specific binding. Consider using monoclonal antibodies which typically offer higher specificity than polyclonals, though potentially at the cost of sensitivity. For flow cytometry, include proper isotype controls at identical concentrations to the primary antibody. When performing immunoprecipitation, pre-clear lysates with protein A/G beads before adding the DGKA antibody to reduce non-specific binding. For multi-color immunofluorescence, ensure appropriate secondary antibody selection to prevent cross-reactivity. Finally, consult published literature that has successfully used specific DGKA antibody catalog numbers for your application of interest . If problems persist after these optimizations, consider alternative antibody clones or validate additional antibodies using parallel approaches like immunoblotting and immunofluorescence to confirm consistent staining patterns.

What controls should be included in experiments using DGKA antibodies?

Robust experimental design with DGKA antibodies requires comprehensive controls to ensure valid and interpretable results. Include positive controls using samples known to express DGKA—Jurkat cells, HeLa cells, MOLT-4 cells, human/mouse cerebellum tissue, or HEK-293 cells have all been validated as expressing detectable DGKA levels . Negative controls are equally crucial; ideally, use DGKA knockout or knockdown samples generated via CRISPR-Cas9 or siRNA approaches . In their absence, samples known to express very low DGKA levels can serve as relative negative controls. For immunohistochemistry and immunofluorescence, include technical controls omitting primary antibody while maintaining all other steps to identify non-specific secondary antibody binding. Loading controls in Western blotting (β-actin, GAPDH, etc.) are essential for normalizing DGKA expression levels. For flow cytometry, include isotype controls using non-specific antibodies of the same isotype, concentration, and fluorophore conjugation as the DGKA antibody. When studying DGKA in functional contexts, include pharmacological controls using DGKA inhibitors like ritanserin to confirm observed phenotypes are specifically related to DGKA activity. For experiments involving DGKA manipulation, include rescue controls where DGKA expression is restored to confirm phenotype specificity. When investigating DGKA in the context of specific signaling pathways, include pathway controls with known activators or inhibitors of those pathways. Finally, for tissue-based studies, include normal adjacent tissue controls alongside tumor samples to establish baseline DGKA expression levels, as demonstrated in studies of lung adenocarcinoma where DGKA expression was substantially increased in carcinoma compared to paired normal tissues .