UPF3A Antibody

What is the biological function of UPF3A in nonsense-mediated mRNA decay (NMD)?

Current evidence demonstrates that:

• UPF3A can engage with release factors and the terminating ribosome

• UPF3A protein levels increase ~3.5-fold in UPF3B mutant cells

• UPF3A associates with NMD complexes and shows increased co-immunoprecipitation with UPF1 in UPF3B-deficient cells

• The co-depletion of both UPF3A and UPF3B results in marked NMD inhibition, suggesting functional redundancy

These findings contradict earlier models suggesting UPF3A acts as an NMD repressor .

What is the expression pattern of UPF3A in human and mouse tissues?

While previous research suggested UPF3A is barely present in commonly cultured human cells, recent findings reveal UPF3A is ubiquitously expressed across mouse and human tissues :

• UPF3A shows highest expression in testis in both humans and mice

• RPKM value of UPF3A is higher than UPF3B in all mouse tissues investigated

• UPF3A expression is not lower than UPF3B expression in most tissues of humans and mice

• UPF3A protein is ubiquitously expressed, contrary to earlier antibody-based approaches that failed to detect it in many tissues

This ubiquitous expression pattern supports findings that UPF3A knockout mice are embryonic lethal, suggesting essential roles in organ development and tissue homeostasis .

What is the relationship between UPF3A and UPF3B expression levels?

UPF3A and UPF3B exhibit an interesting compensatory relationship:

• UPF3A is upregulated ~3.5-fold in UPF3B mutant cells at both protein and mRNA levels (1.8-fold increase)

• UPF3B depletion by gene knockout or knockdown strategies dramatically increases UPF3A protein levels

• In wild-type cells, UPF1 mainly associates with UPF3B and only minimally with UPF3A, but in UPF3B mutant cells, UPF1-UPF3A association is enhanced ~4-6 fold

• This compensatory mechanism appears to maintain NMD efficiency even in the absence of UPF3B

How do I select the appropriate UPF3A antibody for my experimental system?

When selecting a UPF3A antibody, consider these factors based on experimental needs:

• Antibody specificity: Determine whether you need an antibody specific to UPF3A or one that detects both UPF3A and UPF3B

  • Some antibodies (e.g., Abcam 269998) can detect both UPF3A and UPF3B simultaneously in a single blot

  • UPF3A-specific antibodies are necessary for distinguishing between paralogs

• Application compatibility: Verify the antibody is validated for your application:

  Application	Recommended Dilution
  Western Blot	1:500-1:2000
  Immunohistochemistry	1:50-1:500
  Immunofluorescence	1:20-1:200

• Species reactivity: Ensure the antibody reacts with your species of interest

  • Commercial antibodies may specify reactivity (e.g., human, mouse)

  • Cross-reactivity between species should be experimentally validated

• Validation data: Review published literature and manufacturer validation data for:

  • Observed molecular weight (typically 55 kDa for UPF3A)

  • Positive detection in relevant cell lines (e.g., HEK-293, HeLa, Jurkat cells)

How can I validate an antibody's specificity for detecting endogenous UPF3A?

To validate antibody specificity for endogenous UPF3A:

• RNA interference approach:

  • Use siRNA or shRNA targeting UPF3A (sample sequences from literature: shUPF3a-1: TACTCAAGAGCATACATTAAT; shUPF3a-2: GACGTAGAAACACGCAGAAAC; shUPF3a-3: GATGTGGAGAGATCTCAAGAA)

  • Perform Western blot analysis to confirm reduction of the target band

  • Multiple siRNAs targeting different regions help confirm specificity

• Overexpression controls:

  • Clone UPF3A coding sequence into an expression vector

  • Transfect cells and verify increased band intensity at expected molecular weight

  • Inclusion of a tag (e.g., FLAG) can help distinguish exogenous from endogenous protein

• CRISPR-Cas9 knockout validation:

  • Generate UPF3A knockout cells using CRISPR-Cas9

  • Confirm complete absence of the specific band

  • Western blot analysis should show no detection in knockout cells

• Comparative analysis with known antibodies:

  • Compare results with previously validated antibodies

  • Observe band pattern consistency between antibodies

  • Note that some antibodies detecting both UPF3A and UPF3B show a distinct two-band pattern with UPF3B as the upper band and UPF3A as the lower band

• Positive and negative cell/tissue controls:

  • Include tissues known to express high levels of UPF3A (e.g., testis) as positive controls

  • Compare with cell lines known to have very low UPF3A expression

What are the experimental considerations when using antibodies that detect both UPF3A and UPF3B?

When using antibodies that detect both UPF3A and UPF3B (e.g., Abcam UPF3A+UPF3B antibody):

• Band identification strategy:

  • UPF3A and UPF3B typically appear as distinct bands between 52-66 kDa

  • UPF3B generally corresponds to the upper band (~55-66 kDa)

  • UPF3A generally corresponds to the lower band (~52-55 kDa)

• Validation approaches:

  • Perform siRNA knockdown of UPF3B, which should diminish the upper band and induce increased intensity of the lower UPF3A band

  • Perform siRNA knockdown of UPF3A, which should diminish the lower band

  • Overexpress tagged versions of UPF3A and UPF3B to confirm band positions

• Quantification challenges:

  • When quantifying relative expression, account for the compensatory relationship where UPF3B depletion increases UPF3A expression

  • Use appropriate loading controls

  • Consider using densitometry to quantify the relative intensities of each band

• Avoiding technical artifacts:

  • Control for antibody cross-reactivity with other proteins

  • Some UPF3A antibodies yield co-migrating cross-reacting bands that may confound interpretation

  • Optimize gel percentage to achieve better separation between the paralogs

What are the optimal protocols for immunohistochemical detection of UPF3A in tissue samples?

For optimal immunohistochemical detection of UPF3A in tissue samples:

• Tissue preparation:

  • Deparaffinize tissue microarrays (TMA) or tissue sections

  • Perform antigen retrieval with citrate buffer (pH 6.0) or TE buffer (pH 9.0)

  • Block endogenous peroxidases with 3% hydrogen peroxide

  • Block nonspecific antigens with 5% goat serum

• Antibody incubation:

  • Dilute primary UPF3A antibody 1:50-1:500 (e.g., Proteintech antibody at 1:500)

  • Incubate overnight at 4°C

  • Wash three times with phosphate-buffered saline (PBS)

  • Apply appropriate secondary antibody for 1 hour at room temperature

• Detection and visualization:

  • Develop with diaminobenzidine chromogen

  • Counterstain with hematoxylin

  • Cover slip for microscopic examination

• Controls for validation:

  • Include positive control tissues known to express UPF3A (e.g., testis, heart)

  • Include negative controls (primary antibody omission)

  • Consider including UPF3A-knockdown tissues as specificity controls

• Evaluation parameters:

  • Assess subcellular localization (typically nuclear/cytoplasmic)

  • Quantify staining intensity and percentage of positive cells

  • Compare expression levels across different tissues or pathological conditions

How can I design experiments to study the functional redundancy between UPF3A and UPF3B?

To study functional redundancy between UPF3A and UPF3B:

• Generate single and double knockout models:

  • Create UPF3A knockout, UPF3B knockout, and UPF3A/UPF3B double knockout cell lines using CRISPR-Cas9

  • Confirm knockout efficiency by Western blot and qPCR

• Assess NMD activity:

  • Measure expression levels of known NMD targets by RT-qPCR in each knockout condition

  • Perform RNA-Seq analysis to identify transcriptome-wide changes in NMD substrates

  • Compare the effects of single knockouts versus double knockout to assess redundancy

• Rescue experiments:

  • Reintroduce UPF3A or UPF3B into the double knockout cells

  • Create domain mutants (e.g., UPF2 or EJC binding-deficient UPF3B) to test specific functional domains

  • Assess restoration of NMD activity

• Protein-protein interaction studies:

  • Perform co-immunoprecipitation experiments to analyze UPF3A and UPF3B interactions with NMD factors like UPF1

  • Compare interaction partners in wildtype versus knockout backgrounds

  • Assess whether UPF3A-UPF1 association increases in UPF3B knockout cells

• Tissue-specific analysis in model organisms:

  • Generate conditional knockout mice to study tissue-specific effects

  • Compare phenotypes of single versus double knockouts in specific tissues

  • Analyze compensatory upregulation of UPF3A in UPF3B-deficient tissues

What are the recommended experimental approaches to study UPF3A in clinical samples?

For studying UPF3A in clinical samples:

• Expression analysis in disease tissues:

  • Perform immunohistochemistry on tissue microarrays (TMAs) to assess UPF3A expression

  • Compare expression between normal and diseased tissues

  • Correlate expression with clinical parameters (e.g., stage, metastasis)

• Prognostic value assessment:

  • Analyze associations between UPF3A expression and clinical outcomes

  • Consider parameters such as TNM stage, metastasis, and recurrence

  • In colorectal cancer, high UPF3A expression has been significantly associated with TNM stage (p=0.009), liver metastasis, and recurrence (p<0.001)

• Functional studies in patient-derived cells:

  • Establish primary cell cultures from patient samples

  • Perform UPF3A knockdown using validated shRNA sequences

  • Assess effects on cell migration, invasion, and other cancer-relevant phenotypes

• Molecular profiling:

  • Conduct RNA-Seq to identify UPF3A-regulated transcripts in patient samples

  • Perform pathway analysis to understand disease-relevant mechanisms

  • Correlate with protein expression data

• Validation cohorts:

  • Use multiple independent patient cohorts to validate findings

  • Consider demographic and clinical variables

  • Validate in different disease subtypes

How do UPF3A and UPF3B differentially regulate specific subsets of NMD targets?

Understanding the differential regulation of NMD targets by UPF3A and UPF3B requires sophisticated experimental approaches:

• Transcriptome-wide analysis:

  • Perform RNA-Seq in wildtype, UPF3A knockout, UPF3B knockout, and double knockout cells

  • Identify transcripts uniquely affected by each knockout condition

  • In UPF3B mutant cells, some NMD targets are UPF3B-dependent while others are UPF3B-independent

  • UPF3A knockdown in UPF3B-deficient cells shows stronger effects on UPF3B-dependent NMD targets compared to UPF3B-independent targets

• Mechanistic investigation:

  • Compare EJC-dependent versus EJC-independent NMD substrates

  • Analyze positional effects (e.g., proximity of premature termination codons to EJCs)

  • Investigate 3'UTR length effects on UPF3A versus UPF3B sensitivity

• Domain-specific functions:

  • Generate domain mutants of UPF3A and UPF3B (e.g., EJC-binding deficient)

  • Determine which domains are responsible for target specificity

  • Research shows UPF3B largely retains NMD activity even when UPF2 or EJC binding is deficient

• Interaction partner analysis:

  • Identify specific interaction partners for UPF3A versus UPF3B

  • Investigate how these interactions influence target selection

  • Assess whether UPF3A and UPF3B compete for common binding partners

• Deep sequencing of NMD intermediates:

  • Use techniques to capture decay intermediates

  • Compare decay kinetics between different targets

  • Analyze position-dependent effects on decay efficiency

What is the current understanding of UPF3A's role in disease pathogenesis?

The role of UPF3A in disease pathogenesis is an emerging area of research:

• Cancer progression:

  • High UPF3A expression is significantly associated with TNM stage (p=0.009), liver metastasis and recurrence (p<0.001) in colorectal cancer (CRC) patients

  • Functional studies demonstrate that UPF3A knockdown impairs CRC cell mobility, while UPF3A overexpression promotes cell migration

  • These findings suggest UPF3A may contribute to cancer metastasis and progression

• Developmental disorders:

  • UPF3A knockout mice are embryonic lethal, suggesting essential roles in development

  • The ubiquitous expression of UPF3A across tissues indicates potential functions in organ development and tissue homeostasis

  • Further research is needed to identify specific developmental processes regulated by UPF3A

• Neurological disorders:

  • While UPF3B mutations have been linked to neurodevelopmental disorders, the compensatory role of UPF3A in these conditions remains to be fully explored

  • Understanding how UPF3A compensates for UPF3B deficiency may provide insights into disease mechanisms and potential therapeutic approaches

• Other pathological conditions:

  • Research on UPF3A's role in inflammation, immunity, and cellular stress responses is limited

  • Further investigation of UPF3A function in various disease models is warranted

• Potential as a biomarker:

  • UPF3A expression patterns could serve as diagnostic or prognostic biomarkers in certain cancers

  • Validation in larger patient cohorts is needed

How does post-translational modification affect UPF3A function and stability?

The regulation of UPF3A through post-translational modifications remains an understudied area:

• Protein stability regulation:

  • UPF3A is destabilized when not bound to UPF2, resulting in rapid turnover of "free" UPF3A

  • The mechanisms governing this selective degradation are not fully understood

  • Investigating potential ubiquitination sites and relevant E3 ligases would provide insights

• Phosphorylation analysis:

  • Identify potential phosphorylation sites using mass spectrometry

  • Determine kinases responsible for UPF3A phosphorylation

  • Create phospho-mimetic and phospho-deficient mutants to assess functional consequences

• Subcellular localization:

  • Investigate how post-translational modifications affect UPF3A's nuclear-cytoplasmic shuttling

  • Determine whether modifications regulate EJC or UPF2 binding

  • Use fluorescence microscopy to track modified versus unmodified UPF3A

• Interaction dynamics:

  • Assess how modifications influence UPF3A's interaction with NMD factors

  • Determine whether UPF3A and UPF3B undergo differential modifications

  • Investigate whether UPF3B depletion affects the modification status of UPF3A

• Cell cycle-dependent regulation:

  • Analyze whether UPF3A undergoes cell cycle-dependent modifications

  • Compare modification patterns across different tissues

  • Assess developmental stage-specific modifications

What are common technical challenges when detecting UPF3A protein and how can they be overcome?

Researchers often encounter these challenges when detecting UPF3A:

• Low endogenous expression levels:

  • UPF3A is barely detectable in many commonly cultured cell lines

  • Solution: Use sensitive detection methods (enhanced chemiluminescence, fluorescent secondary antibodies)

  • Consider concentrating protein samples or immunoprecipitation before Western blot

• Cross-reactivity and non-specific bands:

  • Some UPF3A antibodies yield co-migrating cross-reacting bands

  • Solution: Include proper controls (UPF3A knockdown/knockout) to identify specific bands

  • Optimize antibody dilutions and blocking conditions

• Distinguishing from UPF3B:

  • UPF3A and UPF3B have similar molecular weights

  • Solution: Use high-resolution gels (10-12% acrylamide) for better separation

  • For antibodies detecting both proteins, UPF3B typically appears as the upper band (55-66 kDa) and UPF3A as the lower band (52-55 kDa)

• Compensatory upregulation:

  • UPF3A is upregulated in UPF3B-deficient cells, complicating interpretation

  • Solution: Include appropriate controls and consider the biological context when interpreting results

  • Use quantitative methods (qPCR, mass spectrometry) to assess relative levels

• Tissue-specific expression:

  • UPF3A expression varies across tissues, with highest levels in testis

  • Solution: Include positive control tissues (e.g., testis) when establishing detection methods

  • Optimize extraction protocols for different tissue types

How should researchers interpret conflicting results regarding UPF3A function in the literature?

When facing conflicting literature about UPF3A function:

What are the recommended controls for RNA interference experiments targeting UPF3A?

For robust RNA interference experiments targeting UPF3A:

• Multiple siRNA/shRNA sequences:

  • Use at least 3 independent siRNA/shRNA sequences targeting different regions of UPF3A

  • Example validated sequences: shUPF3a-1: TACTCAAGAGCATACATTAAT; shUPF3a-2: GACGTAGAAACACGCAGAAAC; shUPF3a-3: GATGTGGAGAGATCTCAAGAA

  • Compare phenotypes across different targeting sequences to rule out off-target effects

• Appropriate negative controls:

  • Include non-targeting siRNA/shRNA with similar GC content

  • Include mock transfection controls (reagent only)

  • Untreated cells should also be analyzed

• Knockdown validation:

  • Verify knockdown efficiency at both mRNA level (qRT-PCR) and protein level (Western blot)

  • Consider temporal validation (24h, 48h, 72h post-transfection) to determine optimal time point

  • Quantify knockdown efficiency relative to control samples

• Rescue experiments:

  • Perform rescue with siRNA/shRNA-resistant UPF3A constructs

  • Compare wild-type rescue with domain mutants to identify critical functional regions

  • Ensure expression levels are comparable to endogenous UPF3A

• Monitoring compensatory effects:

  • Assess changes in UPF3B expression upon UPF3A knockdown

  • Monitor other NMD factors that might be altered

  • Consider combined knockdown of UPF3A and UPF3B to reveal functional redundancy