UQCRH Human

What is UQCRH and what is its primary function in human cells?

UQCRH (Ubiquinol Cytochrome c Reductase Hinge) is a protein that localizes in the mitochondrial membrane and serves as a structural subunit of respiratory complex III (cytochrome bc1 complex). It plays a crucial role in the electron transport chain during mitochondrial respiration. The protein facilitates the transfer of electrons between ubiquinol and cytochrome c, contributing to ATP production. UQCRH also influences the generation of mitochondrial reactive oxygen species (ROS), which has implications for cellular signaling and oxidative stress responses . For experimental investigation of UQCRH function, researchers typically employ spectrophotometric assays to measure complex III activity in isolated mitochondria, with deficiency characterized by decreased electron transfer rates.

How is UQCRH expression typically measured in research settings?

UQCRH expression can be quantified through several complementary approaches:

• RNA level detection: Researchers commonly employ semiquantitative and quantitative real-time reverse transcriptase polymerase chain reaction (RT-PCR). The primers and probe sequences used in validated protocols include:

  • UQCRH, 5′‐GCAAAAGATGCTTACCGAATCCG‐3′ (sense)

  • 5′‐CTCTCTCACTGTTGTTAGGGGATC‐3′ (antisense)

  • 5′‐FAM‐TCCTCCTCTTCCTCTTCCTCCTCCTCA‐BHQ‐1‐3′ (probe)

• Protein detection: Immunohistochemistry (IHC) using anti-UQCRH antibodies (typically at 1:150 dilution) with scoring systems based on percentage of positive cells:

  • High (+++) expression: >35% positive cells

  • Medium (++) expression: 18-35% positive cells

  • Low/negative (±) expression: ≤17% positive cells

• Serum detection: ELISA assays can quantify circulating UQCRH levels, which is particularly relevant for biomarker applications .

The choice of method depends on the specific research question, with tissue-based assays preferred for localization studies and serum-based tests for biomarker research.

What evidence supports UQCRH as a potential diagnostic biomarker for lung adenocarcinoma?

UQCRH has demonstrated considerable potential as a diagnostic biomarker for lung adenocarcinoma based on multiple lines of evidence:

• Tissue expression patterns: UQCRH shows a high expression rate of 87.10% (108/124) in lung adenocarcinoma tissues compared to adjacent normal tissues .

• Serum diagnostic performance: ROC curve analysis revealed:

  • Optimal cut-off value: 162.65 pg/ml

  • Sensitivity: 88.7%

  • Specificity: 85.7%

  • Area under the curve: 0.927 (95% CI: 0.892 to 0.962, p < 0.0001)

• Differential diagnosis: Serum UQCRH levels in lung adenocarcinoma patients were significantly elevated compared to:

  • Pneumonia patients (p < 0.0001)

  • Normal control subjects (p < 0.0001)

How does UQCRH expression correlate with clinical outcomes in hepatocellular carcinoma?

UQCRH overexpression in hepatocellular carcinoma (HCC) correlates with several adverse clinicopathological features and poorer patient outcomes:

Methodologically, researchers determined the optimal cutoff point for UQCRH expression by testing all possible P-values using log-rank tests between high and low expression groups, selecting the ratio that yielded the lowest P-value. This statistical approach offers a model for establishing clinically relevant expression thresholds in biomarker studies .

What are the clinical manifestations of UQCRH deficiency in humans?

UQCRH deficiency manifests as a clinically distinct mitochondrial complex III disorder with characteristic presentations:

• Clinical presentation: Patients with homozygous two-exon deletion in UQCRH present with:

  • Recurrent episodes of metabolic crisis

  • Lactic acidosis

  • Hyperammonaemia

  • Impaired glucose homeostasis

• Episodic nature: Unlike many mitochondrial disorders, UQCRH deficiency shows an episodic pattern with normal development between crises .

• Biochemical hallmarks: Patient tissues display:

  • Impaired complex III activity

  • Decreased molecular weight of fully assembled holoenzyme

  • Increased formation of an abnormal large supercomplex (SXL), comprising primarily one complex I dimer and one complex III dimer

The recognition of these specific manifestations is crucial for proper diagnosis, particularly in distinguishing UQCRH deficiency from other mitochondrial disorders with overlapping presentations.

How do the mouse models of UQCRH deficiency compare with human disease manifestations?

Mouse models of UQCRH deficiency (Uqcrh-/- mice) show important similarities and differences compared to human patients:

The biochemical phenotypes observed in both patient and Uqcrh-/- mouse tissues were remarkably similar, validating the mouse model as a valuable tool for studying human complex III deficiency mechanisms. The more severe phenotype in mice might be explained by species-specific compensatory mechanisms or the absence of the pseudogene UQCRHL in mice, which is present in humans .

What experimental validation techniques can verify the pathogenicity of UQCRH mutations?

Multiple complementary approaches can be employed to verify the pathogenicity of UQCRH mutations:

• Comparative phenotyping: Compare biochemical and clinical phenotypes between patients and animal models with equivalent genetic defects. Similar patterns of:

  • Complex III activity impairment

  • Supercomplex assembly abnormalities

  • Metabolic disturbances (lactic acidosis, hyperammonaemia)
    Provide strong evidence for pathogenicity .

• Lentiviral rescue experiments: Patient fibroblasts can be transduced with wild-type UQCRH to demonstrate phenotypic rescue. Normalization of:

  • Complex III activity

  • Supercomplex assembly

  • Mitochondrial respiration
    Following complementation confirms the causal relationship between the mutation and observed defects .

• Functional genomics: Techniques such as whole exome sequencing (WES) coupled with GeneMatcher can help identify additional cases with similar genetic variants, strengthening genotype-phenotype correlations .

• Biochemical characterization: Detailed analysis of respiratory chain complex activities, particularly complex III, using spectrophotometric assays in patient-derived tissues and cells compared to controls .

These methodological approaches should be applied systematically, with appropriate controls, to establish firm evidence for pathogenicity of UQCRH variants identified in clinical settings.

What are the most reliable methods for quantifying UQCRH in clinical samples for biomarker research?

For reliable quantification of UQCRH in clinical samples, researchers should consider the following validated methodologies:

• Serum ELISA:

  • Offers standardized quantification with high reproducibility

  • Established cut-off values (e.g., 162.65 pg/ml for lung adenocarcinoma)

  • Enables comparison of sensitivity and specificity with conventional markers like CEA

  • Suitable for large-scale screening studies

• RT-qPCR for tissue samples:

  • Primers: UQCRH forward 5′-AGGGACCATTGCGTGGCC-3′ and reverse 5′-AGCTACCAGCCTAAGCCAAA-3′

  • Recommended conditions: 95°C 15s, 67°C 1min for 35 cycles with initial denaturation at 95°C for 10min

  • Results should be normalized to appropriate reference genes (e.g., 18S rRNA)

  • The comparative threshold cycle (2−ΔΔC(t)) method is recommended for relative expression analysis

• Immunohistochemistry scoring:

  • Standardized antibody dilution (1:150 recommended)

  • Systematic sampling (five random images at ×400 magnification)

  • Consistent scoring system based on percentage of positive cells

  • Independent evaluation by at least two pathologists

For optimal biomarker validation, researchers should:

• Include appropriate disease and healthy controls

• Perform ROC curve analysis to establish cut-off values

• Calculate sensitivity, specificity, and area under the curve

• Compare performance against established biomarkers

• Account for potential confounding factors (e.g., smoking status in lung cancer studies)

What is the role of UQCRH in mitochondrial supercomplex formation and stability?

UQCRH plays a critical role in the assembly and stability of mitochondrial supercomplexes, with its absence leading to significant structural alterations:

• Normal function: UQCRH serves as a structural component of complex III (cytochrome bc1 complex), facilitating proper assembly and integration into respiratory supercomplexes .

• Consequences of UQCRH absence:

  • Decreased molecular weight of fully assembled complex III holoenzyme

  • Altered supercomplex composition

  • Formation of an abnormal large supercomplex (SXL), primarily comprising one complex I dimer and one complex III dimer

• Dimerization effects: Despite UQCRH absence, complex III can still dimerize, suggesting that UQCRH is not essential for the dimerization process itself but rather influences the stability and composition of higher-order supercomplexes .

These findings indicate that UQCRH contributes to the structural integrity of the respiratory chain organization beyond its catalytic role. Research into these structural aspects provides insight into how specific subunit deficiencies can lead to broader respiratory chain dysfunction through altered supercomplex dynamics.

How does UQCRH overexpression contribute to cancer progression at the molecular level?

UQCRH overexpression appears to contribute to cancer progression through several interconnected molecular mechanisms:

• Mitochondrial ROS generation: UQCRH induces mitochondrial reactive oxygen species (ROS) generation, which can:

  • Promote DNA damage and genomic instability

  • Activate oncogenic signaling pathways

  • Induce metabolic adaptations favoring cancer cell survival

• Effects on electron transport chain function: Altered UQCRH expression affects the efficiency of mitochondrial respiration, potentially contributing to the Warburg effect and metabolic reprogramming characteristic of cancer cells .

• Clinical correlations: UQCRH overexpression associates with:

  • Larger tumor size

  • Poorer differentiation

  • Vascular invasion
    Suggesting potential roles in proliferation, dedifferentiation, and metastatic processes .

• Potential therapeutic implications: The connection between UQCRH and cancer aggressiveness suggests it could serve as a therapeutic target, particularly for approaches targeting mitochondrial metabolism. Experimental inhibition of complex III in UQCRH-overexpressing tumors might selectively affect cancer cells reliant on altered mitochondrial function .

Understanding these molecular mechanisms provides a foundation for both diagnostic applications and potential therapeutic interventions targeting UQCRH or its downstream effects in cancer.

What are the key considerations when designing experiments to study UQCRH function in human cell models?

When designing experiments to study UQCRH function in human cell models, researchers should consider several critical factors:

• Cell type selection:

  • Primary cells versus established cell lines

  • Cancer versus non-cancer models

  • Cells with high versus low mitochondrial content

  • Patient-derived versus control cells for disease studies

• Genetic manipulation approaches:

  • CRISPR/Cas9 for gene knockout or introduction of specific mutations

  • shRNA/siRNA for knockdown studies

  • Lentiviral vectors for rescue experiments (demonstrated effective in patient fibroblasts)

  • Overexpression systems to model cancer-related UQCRH upregulation

• Functional readouts:

  • Complex III activity (spectrophotometric assays)

  • Oxygen consumption rate measurements

  • ATP production assays

  • ROS detection methods

  • Supercomplex assembly analysis via Blue Native PAGE

• Controls and validation:

  • Multiple cell lines/primary cells to ensure robustness

  • Multiple methodologies to confirm findings

  • Rescue experiments to verify specificity

  • Appropriate reference genes for expression studies

• Physiological relevance:

  • Culture conditions mimicking tissue microenvironment

  • Consideration of oxygen tension (normoxia vs. hypoxia)

  • Metabolic substrate availability

  • Stress conditions to reveal phenotypes (e.g., metabolic challenge)

These considerations ensure experimental designs that yield physiologically relevant and reproducible insights into UQCRH function in human cells.

How can researchers effectively measure the impact of UQCRH alterations on mitochondrial function?

Researchers can employ a comprehensive panel of complementary approaches to effectively assess the impact of UQCRH alterations on mitochondrial function:

• Enzymatic activity assays:

  • Complex III (ubiquinol-cytochrome c reductase) activity using spectrophotometric methods

  • Combined complex activities (I+III, II+III) to assess integrated electron transfer

  • Individual complex activities (I, II, IV, V) to identify compensatory mechanisms

  • Citrate synthase activity as mitochondrial mass control

• Respiratory capacity measurements:

  • Oxygen consumption rate (OCR) using Seahorse XF analyzers

  • High-resolution respirometry with Oroboros O2k

  • Substrate-specific respiration (carbohydrates vs. fatty acids)

  • Coupling efficiency and spare respiratory capacity

• Mitochondrial membrane potential:

  • Potentiometric dyes (TMRM, JC-1)

  • Flow cytometry or microscopy-based quantification

  • Time-lapse imaging for dynamic assessment

• Reactive oxygen species (ROS):

  • Mitochondrial superoxide (MitoSOX)

  • Hydrogen peroxide (Amplex Red)

  • Cellular oxidative damage markers (protein carbonylation, lipid peroxidation)

  • Antioxidant system responses

• Supercomplex analysis:

  • Blue Native PAGE

  • In-gel activity assays

  • Proteomic analysis of supercomplex composition

  • Structural imaging via cryo-EM

• Metabolic profiling:

  • Lactate production (marker of glycolytic shift)

  • ATP/ADP ratio

  • NAD+/NADH ratio

  • Metabolomic analysis of TCA cycle intermediates

This multi-parameter assessment provides a comprehensive picture of how UQCRH alterations affect not only complex III function but also broader mitochondrial physiology and cellular metabolism.