USP42 Antibody

What is USP42 and why is it important in cellular research?

USP42 (Ubiquitin-specific peptidase 42) is a deubiquitylating enzyme that belongs to the peptidase C19 family and consists of 1,325 amino acids . The protein plays crucial roles in multiple cellular processes by removing ubiquitin from target proteins, thereby preventing their degradation through the ubiquitin-proteasome pathway. USP42 is particularly important in research because it regulates several vital cellular mechanisms:

• It contributes to p53 stabilization in stress responses, making it relevant for cancer research .

• It functions in transcriptional regulation by deubiquitylating histone H2B .

• It directs nuclear speckle phase separation and regulates mRNA splicing .

• It modulates Wnt signaling by protecting ZNRF3/RNF43 from degradation .

These diverse functions make USP42 an important research target for understanding fundamental cellular processes and disease mechanisms, particularly in cancer biology.

What detection methods can be used with USP42 antibodies?

USP42 antibodies can be employed in multiple detection techniques, with each offering distinct advantages depending on research objectives. The mouse monoclonal USP42 antibody (D-4) has been validated for:

• Western blotting (WB): For quantitative analysis of USP42 protein expression levels .

• Immunoprecipitation (IP): To isolate USP42 protein complexes and identify interaction partners .

• Immunofluorescence (IF): For visualizing subcellular localization, particularly in nuclear foci where USP42 co-localizes with RNA polymerase II .

• Immunohistochemistry (IHC): For detection in tissue samples .

• Enzyme-linked immunosorbent assay (ELISA): For quantitative protein detection .

For optimal results in immunofluorescence studies, super-resolution microscopy techniques such as 3D structured illumination-based imaging systems have been successfully employed to visualize USP42 in nuclear speckles . Standard fluorescence microscopy and confocal imaging with Leica laser scanning microscopes (TCS SP5 and SP8) have also produced reliable results when studying USP42 localization .

How should I prepare cell samples for USP42 immunofluorescence studies?

For effective immunofluorescence detection of USP42, researchers should follow this validated protocol:

• Wash treated cells with PBS to remove media components.

• Fix cells in 3% paraformaldehyde for 15 minutes at room temperature.

• Incubate with ammonium chloride for 15 minutes to quench autofluorescence.

• Permeabilize cells with 0.2% Triton X-100 to allow antibody penetration.

• Block with 2% BSA for 30 minutes to reduce non-specific binding.

• Incubate with primary USP42 antibody for 1 hour at room temperature.

• Wash thoroughly with PBS to remove unbound antibody.

• Stain with appropriate secondary antibody for 1 hour at room temperature.

• Mount coverslips using Mowiol, adding DAPI for nuclear visualization .

For co-localization studies, particularly with RNA Pol II or SC35 (a nuclear speckle marker), dual immunostaining can be performed by including appropriate antibodies during the primary and secondary antibody incubation steps. This approach has successfully demonstrated USP42's association with nuclear speckles and transcriptional machinery .

How can I effectively silence USP42 expression in experimental models?

Two primary approaches have been validated for USP42 silencing in research models:

• siRNA-mediated knockdown:

  • Two effective siRNA treatments (siRNA 2 and siRNA 7) have demonstrated significant USP42 silencing effects.

  • At the mRNA level, both treatments achieve approximately 60% silencing at 24 and 48 hours.

  • By 72 hours, silencing efficiency decreases to 51% (siRNA 2) and 45% (siRNA 7) .

  • For protein level silencing, siRNA 7 achieves significant reduction (32%) at 72 hours post-treatment, while siRNA 2 shows no significant protein expression changes up to 72 hours .

• CRISPR/Cas9-mediated depletion:

  • Guide RNA sequences GGCTTATTTTGCAAGGCGTG (gRNA#1) and CTCGAATAAACTACAGCACC (gRNA#2) have been validated for USP42 targeting.

  • These sequences can be inserted into the pSpCas9(BB)-2A-GFP (PX458) expression vector.

  • After transfection, GFP-positive cells can be isolated via flow cytometry (BD FACSAria II).

  • Single clones should be expanded and validated for USP42 knockout by immunoblotting .

The temporal dynamics of silencing should be carefully considered when designing experiments, as the siRNA approach shows variable efficiency over time and different effects at mRNA versus protein levels.

What are the functional consequences of USP42 depletion in different cellular contexts?

USP42 depletion produces distinct functional outcomes depending on cellular context:

• In transcriptional regulation:

  • Increased histone H2B ubiquitylation at promoters .

  • Decreased basal and induced transcription from multiple promoters .

  • Stalling of RNA Pol II at transcriptional start sites .

  • Deregulation of multiple mRNA splicing events .

• In Wnt signaling (colon cancer cells):

  • Increased surface levels of endogenous LRP6 Wnt receptors .

  • Enhanced paracrine Wnt signaling activity .

  • Upregulation of stem cell Wnt target gene LGR5 .

  • Increased expression of the Wnt target AXIN2 in response to Wnt3a .

• In cancer cell biology:

  • Deterred cancer cell growth in certain contexts .

  • Potential hypersensitivity to Wnt signaling in intestinal organoids .

These diverse outcomes underscore the importance of selecting appropriate cellular models and readouts when studying USP42 function, as its role appears to be highly context-dependent and pathway-specific.

How does USP42 interact with chromatin and the transcriptional machinery?

USP42 exhibits specific interactions with chromatin components and transcriptional machinery through multiple mechanisms:

• Chromatin association:

  • USP42 binds directly to histone H2B as confirmed by co-immunoprecipitation studies .

  • This interaction depends on USP42's linker domain and C-terminal lysine-rich domain .

  • USP42 efficiently deubiquitylates histones H2A and H2B in vitro .

• Transcriptional machinery interactions:

  • USP42 co-localizes with RNA polymerase II in nuclear foci .

  • Both total and phosphorylated (activated) RNA Pol II forms associate with USP42 .

  • Endogenous USP42 and RNA Pol II co-immunoprecipitate, confirming their physical interaction .

• Domain-specific functions:

  • The C120A mutant (DUB-inactive) retains histone H2B binding but loses deubiquitylation activity .

  • The ΔKK mutant (lacking C-terminal lysine-rich domain) shows reduced H2B binding and diffuse nuclear localization rather than nuclear foci .

  • The Δlinker mutant loses H2B binding capacity and relocates to subnuclear structures likely to be nucleoli .

These structure-function relationships provide important insights for designing domain-specific mutants when investigating USP42's varied cellular roles.

What is known about USP42's role in cancer biology?

USP42 exhibits significant implications for cancer biology across multiple tumor types:

These diverse roles suggest that USP42 may function as both a tumor suppressor or oncogene depending on cancer type and molecular context, making it an important but complex target for cancer research.

How does USP42 regulate the Wnt signaling pathway in cancer models?

USP42 functions as a negative regulator of Wnt signaling through a specific molecular mechanism:

• Protection of Wnt pathway negative regulators:

  • USP42 binds to the Dishevelled interacting region (DIR) of ZNRF3 .

  • It protects ZNRF3/RNF43 from R-spondin-induced and ubiquitin-dependent clearance at the plasma membrane .

  • This function stalls the ZNRF3/LGR/RSPO complex formation .

• Functional consequences:

  • USP42 promotes turnover of Wnt receptors LRP6 and Frizzled (FZD) .

  • This reduces surface expression of Wnt receptors, thereby inhibiting Wnt/β-catenin signaling .

  • Knockdown of USP42 increases surface levels of endogenous LRP6, even upon R-spondin treatment .

• Experimental validation:

  • Cell surface protein biotinylation assays demonstrate that USP42 expression reduces ubiquitination of ZNRF3 and RNF43 at the plasma membrane .

  • USP42 strongly increases ZNRF3 and RNF43 residence at the plasma membrane .

  • In intestinal organoids, genetic ablation of Usp42 confers Wnt hypersensitivity .

These findings position USP42 as a critical negative regulator of Wnt signaling, with potential implications for targeting this pathway in cancers where aberrant Wnt activation drives disease progression.

What is the relationship between USP42 and nuclear speckle organization?

USP42 plays a critical role in nuclear speckle organization through the following mechanisms:

These findings establish USP42 as a critical regulator of nuclear speckle dynamics with important implications for both basic cellular biology and potential therapeutic targeting in cancer.

What controls should be included when performing USP42 knockdown experiments?

When designing USP42 knockdown experiments, several essential controls should be included to ensure data validity:

• Negative controls:

  • Non-targeting siRNA or empty vector controls to account for non-specific effects of transfection procedures .

  • These controls are essential reference points for normalizing gene expression and protein levels.

• Validation of knockdown efficiency:

  • RT-qPCR with the 2^-ΔΔCt method to quantify mRNA expression levels at multiple timepoints (24h, 48h, 72h) .

  • Western blot analysis to confirm protein-level knockdown, particularly important since mRNA and protein silencing kinetics may differ .

• Functional controls:

  • For transcriptional studies: measure known USP42-dependent gene targets like p21 .

  • For Wnt signaling studies: include R-spondin treatment conditions to test pathway modulation .

  • For nuclear speckle studies: include SC35 immunofluorescence to assess speckle organization .

• Temporal controls:

  • For siRNA experiments, include multiple timepoints (24h, 48h, 72h) as silencing efficiency may vary over time .

  • For CRISPR/Cas9 experiments, single-cell cloning and verification of knockout status is essential .

Including these controls will help distinguish specific USP42 functions from potential off-target effects and provide appropriate reference points for data interpretation.

What are the advantages and limitations of different USP42 detection methods?

Different USP42 detection methods offer distinct advantages and limitations for research applications:

Researchers should select methods based on specific experimental questions, considering the temporal aspects of USP42 regulation and the biological context being studied.

How can researchers interpret conflicting results in USP42 functional studies?

When encountering conflicting results in USP42 studies, researchers should consider several factors that might explain the discrepancies:

• Context-dependent functions:

  • USP42 exhibits different roles in various cellular contexts (transcription, Wnt signaling, nuclear speckles) .

  • Experiments in different cell types may yield contrasting results due to varying expression levels of interacting partners.

  • The presence or absence of specific stimuli (e.g., stress conditions for p53 studies or R-spondin for Wnt signaling) can alter USP42 function .

• Methodological considerations:

  • Knockdown kinetics: siRNA effects on mRNA (evident at 24h) may precede protein-level changes (significant only at 72h) .

  • Antibody specificity: Different antibodies may recognize distinct USP42 epitopes or functional states.

  • Detection limitations: Some methods may fail to capture dynamic or transient USP42 interactions.

• USP42 domain-specific effects:

  • Mutations affecting different domains show distinct phenotypes - DUB activity (C120A), localization (ΔKK), or binding capacity (Δlinker) .

  • Studies focused on different protein regions may yield seemingly contradictory results.

• Resolution approaches:

  • Employ multiple complementary techniques (e.g., combine IF, IP, and functional assays).

  • Test domain-specific mutants to dissect specific functions .

  • Monitor time-dependent effects, as USP42 functions may vary temporally .

  • Include appropriate controls for each experimental condition.

By considering these factors, researchers can better interpret seemingly conflicting results and integrate them into a more comprehensive understanding of USP42's multifaceted functions.

What emerging applications exist for USP42 antibodies in cancer research?

Several promising research directions are emerging for USP42 antibodies in cancer research:

• Prognostic and diagnostic applications:

  • USP42 expression correlates with prognosis in non-small-cell lung cancer patients .

  • Exploring USP42 as a biomarker in thyroid carcinoma given its mutation in FNMTC families .

  • Investigating USP42 expression patterns across cancer types to identify potential diagnostic applications.

• Therapeutic target validation:

  • Using USP42 antibodies to validate the effects of potential USP42 inhibitors on protein interactions and localization.

  • Monitoring USP42-mediated deubiquitylation of cancer-relevant targets following drug treatments.

  • Correlating USP42 expression with treatment response in patient-derived samples.

• Mechanistic studies:

  • Employing chromatin immunoprecipitation combined with sequencing (ChIP-seq) to identify genome-wide USP42 binding sites.

  • Investigating USP42's role in regulating phase separation in different cancer contexts .

  • Exploring potential synthetic lethal interactions with USP42 inhibition in cancer cells.

• Combination therapy approaches:

  • Studying USP42 in relation to Wnt signaling inhibitors, particularly in colorectal cancers .

  • Investigating potential synergies with p53-activating therapies given USP42's role in p53 regulation .

  • Exploring USP42 inhibition in combination with RNA splicing modulators based on its nuclear speckle functions .

These emerging applications highlight the potential of USP42 antibodies beyond basic research tools, positioning them as valuable reagents for translational cancer research.

How might USP42 function as a therapeutic target in different disease contexts?

USP42 presents distinct therapeutic targeting opportunities across multiple disease contexts:

Each therapeutic context requires careful consideration of USP42's multifunctional nature to achieve desired on-target effects while minimizing potential adverse consequences.

What are the key considerations when selecting USP42 antibodies for specific research applications?

When selecting USP42 antibodies for research, researchers should consider several critical factors to ensure optimal results:

• Application compatibility:

  • Verify that the antibody has been validated for specific applications (WB, IP, IF, IHC, ELISA) .

  • Consider whether conjugated forms (HRP, PE, FITC, Alexa Fluor conjugates) would benefit particular experimental setups .

  • Review published literature demonstrating successful use in similar applications.

• Species reactivity:

  • Confirm reactivity with the species being studied (mouse, rat, human) .

  • For evolutionary studies, consider whether cross-species reactivity is advantageous.

• Epitope specificity:

  • Select antibodies targeting relevant USP42 domains based on research questions:

    • Catalytic domain antibodies for enzymatic studies

    • C-terminal antibodies for phase separation investigations

    • Linker domain antibodies for chromatin interaction studies

• Technical considerations:

  • For USP42 localization studies, select antibodies compatible with fixation protocols .

  • For protein interaction studies, choose antibodies that don't interfere with binding regions.

  • For quantitative analyses, select antibodies with demonstrated linear response ranges.

These considerations should guide antibody selection to ensure that the chosen reagent aligns with specific research objectives and technical requirements, maximizing the probability of successful experimental outcomes while minimizing potential artifacts or limitations.

What are the most significant unanswered questions in USP42 research?

Despite significant advances, several important questions remain unanswered in USP42 research:

• Regulation mechanisms:

  • How is USP42 itself regulated at transcriptional, post-transcriptional, and post-translational levels?

  • What signals or conditions modulate USP42's enzymatic activity or subcellular localization?

  • Do specific post-translational modifications alter USP42 function or substrate specificity?

• Substrate specificity:

  • Beyond histones, p53, and ZNRF3/RNF43, what is the complete repertoire of USP42 substrates?

  • What determines USP42's substrate selection in different cellular contexts?

  • Are there tissue-specific or condition-specific USP42 substrates?

• Disease implications:

  • How do USP42 mutations contribute to cancer development or progression beyond thyroid carcinoma?

  • What is the significance of USP42 expression changes in various cancer types?

  • Could USP42 function as a druggable target in specific disease contexts?

• Structural biology:

  • What is the three-dimensional structure of full-length USP42?

  • How do USP42's various domains cooperate in substrate recognition and catalysis?

  • What structural features enable USP42's phase separation properties?

• System-level functions:

  • How does USP42 integrate its diverse roles in transcription, splicing, and signaling pathways?

  • What compensatory mechanisms exist when USP42 function is compromised?

  • How does USP42 contribute to cellular stress responses beyond p53 regulation?