VAT1 Human

What is VAT1 and what is its primary function in human cells?

VAT1 is a 41-kDa integral membrane protein embedded in synaptic vesicles that serves to transfer monoamines, including norepinephrine, epinephrine, and dopamine, between the cytosol and synaptic vesicles . The protein was first described in the electric organ of the Pacific electric ray Torpedo carlifonica, but its expression is not restricted to neuronal tissues and is also present in normal epithelial tissues . VAT1 functions primarily as a transporter in the dopaminergic system and is preferentially expressed in neuroendocrine cells . The gene encoding VAT1 is positioned directly adjacent to BRCA1, which is associated with inherited predisposition to breast and ovarian cancer .

What experimental approaches are optimal for studying VAT1 expression patterns?

For studying VAT1 expression patterns, researchers should consider multiple complementary techniques:

• RNA Sequencing: RNAseq has been effectively used to detect VAT1 expression levels in patient samples and can reveal differential expression across various tissue types and disease states .

• RT-qPCR: This method is essential for verifying successful overexpression or knockdown of VAT1 in experimental models. In previous studies, RT-qPCR was applied after 48 hours of transfection to confirm expression changes .

• Immunohistochemistry: For tissue-specific localization and expression pattern analysis of VAT1 protein.

• Western Blotting: For quantitative assessment of VAT1 protein levels.

• Single-cell RNA sequencing: For understanding cell-type specific expression patterns of VAT1 within heterogeneous tissues.

What evidence supports VAT1 as a prognostic biomarker in glioblastoma?

Additionally, analysis of TCGA data corroborated these findings, showing that genes associated with high VAT1 expression were functionally involved in angiogenesis and hypoxia, which are hallmarks of tumor development and progression .

How does VAT1 influence cancer cell behavior in experimental models?

Experimental studies have demonstrated that VAT1 significantly impacts several key cancer cell behaviors:

• Cell Proliferation: Knockdown of VAT1 using siRNA resulted in markedly decreased cell viability in GBM cell lines, indicating that VAT1 promotes cancer cell proliferation .

• Cell Migration: VAT1 siRNA-transfected cells showed significantly reduced migration capacity compared to control cells. Quantitative analysis revealed a substantial decrease in the number of migrated cells following VAT1 knockdown .

• Chemotherapy Sensitivity: VAT1 knockdown enhanced sensitivity to temozolomide (TMZ), the standard chemotherapeutic agent for GBM. The half maximal inhibitory concentration (IC50) of TMZ decreased from 5.108 μM in control cells to 3.500 μM in VAT1 siRNA-transfected cells .

These experimental findings provide strong evidence that VAT1 promotes cancer cell proliferation and migration while reducing chemotherapy sensitivity, suggesting its role as an oncogenic factor in GBM.

How is VAT1 expression regulated at the molecular level?

VAT1 expression appears to be regulated through multiple mechanisms:

• MicroRNA Regulation: miR-218 has been identified as a regulator of VAT1 expression. Studies have shown that miR-218 is markedly suppressed in tumors, and upregulation of miR-218 inhibits cell proliferation and migration by targeting various genes including VAT1 . Experimental data demonstrated that VAT1 expression was suppressed when GBM cell lines were transfected with miR-218 .

• Calcium Dependence: VAT1 expression can be influenced by extracellular calcium concentration, suggesting a potential calcium-dependent regulatory mechanism .

• Transcriptional Regulation: Gene expression analyses suggest potential transcriptional regulation mechanisms that vary between normal and pathological states, though detailed transcription factors controlling VAT1 expression require further investigation.

For experimental studies on VAT1 regulation, researchers should consider using reporter gene assays, chromatin immunoprecipitation (ChIP), and microRNA binding site analyses to fully characterize the regulatory landscape.

What are effective methods for VAT1 knockdown in experimental settings?

Based on published research, effective VAT1 knockdown can be achieved using RNA interference techniques:

siRNA Transfection Protocol:

• Design multiple siRNA sequences targeting different regions of VAT1 mRNA. Examples of effective sequences include:

  • siRNA-1: sense GGGAGAAGUUGGGAAGCUACG, antisense UAGCUUCCCAACUUCUCCCUU

  • siRNA-2: sense GGGCUUGACCAGUUCCCAAUC, antisense UUGGGAACUGGUCAAGCCCAG

  • siRNA-3: sense GCUUUGGAGGCUACGACAAGG, antisense UUGUCGUAGCCUCCAAAGCCG

• Seed cells in 6-well plates at a density of 2×10^5 cells/well and culture at 37°C with 5% CO2 for 24 hours before transfection .

• Prepare transfection mixture using Lipofectamine 2000 Reagent and siRNA according to manufacturer's protocol .

• Add transfection mixture to cells and incubate at 37°C with 5% CO2 for 6 hours, then replace medium .

• Verify knockdown efficiency after 48 hours using RT-qPCR .

In previous studies, siRNA-3 demonstrated the strongest interference effect and was therefore selected for subsequent functional assays .

What biological processes and signaling pathways are associated with VAT1 expression?

Gene Ontology (GO) and pathway enrichment analyses of genes differentially expressed based on VAT1 levels have revealed several key biological processes and signaling pathways:

High VAT1 Expression is Associated with:

• Proteolysis

• Oxidation-reduction processes

• Immune response

• Angiogenesis

• Response to hypoxia

Low VAT1 Expression is Associated with:

• Chemical synaptic transmission

• Ion transport

• Neurotransmitter secretion

These associations were consistently observed in both CGGA and TCGA datasets, suggesting robust biological relevance. The correlation between high VAT1 expression and processes like angiogenesis and hypoxia response provides additional support for VAT1's role in tumor development and progression .

How does VAT1 interact with the immune system?

VAT1 appears to have significant interactions with the immune system, particularly in the context of T-cell function:

• T-cell Activation: Studies have identified a significant interaction between CD147 (cluster of differentiation 147) and VAT1, with VAT1 being a novel interacting partner that dynamically engages with CD147 upon T-cell activation .

• Dopamine Regulation in Immune Cells: As a transporter in the dopaminergic system, VAT1 may regulate dopamine levels, which impacts immune cell function. T cells can synthesize, metabolize, release, and recapture dopamine, and VAT1 likely influences these processes .

• Regulatory T Cell Function: Experiments have shown that inhibition of VAT1 with compounds like reserpine in CD4+CD25+ regulatory T cells (Treg) leads to downregulation of intracellular catecholamine concentrations and increased concentrations in the surrounding medium .

These findings suggest that VAT1 may play a role in tumor-associated immunosuppression by influencing T-cell function, potentially through dopamine transport mechanisms.

What methods are optimal for studying small molecule interactions with VAT1?

For investigating small molecule interactions with VAT1, several sophisticated biophysical and biochemical approaches are recommended:

• Surface Plasmon Resonance (SPR): This technique has been successfully used to analyze direct binding between recombinant human VAT1 and small molecules such as EGCg (epigallocatechin-3-gallate) and its alkylated derivatives . SPR provides real-time binding kinetics and affinity measurements.

• Isothermal Titration Calorimetry (ITC): For thermodynamic characterization of binding interactions between VAT1 and potential ligands.

• Fluorescence-based Binding Assays: Including fluorescence polarization or FRET-based approaches to monitor binding interactions.

• X-ray Crystallography: For structural determination of VAT1-ligand complexes at atomic resolution.

• Molecular Docking and MD Simulations: Computational approaches to predict binding modes and affinities.

For functional consequences of binding, researchers should complement these biophysical methods with cellular assays examining changes in VAT1 transport activity or downstream signaling events.

How can researchers evaluate VAT1's role in drug resistance mechanisms?

To evaluate VAT1's contribution to drug resistance, particularly to temozolomide (TMZ) in glioblastoma, researchers should employ a multi-faceted approach:

• Drug Sensitivity Assays: Compare IC50 values between VAT1-normal and VAT1-knockdown cells using dose-response curves. Previous research demonstrated that VAT1 knockdown reduced the IC50 of TMZ from 5.108 μM to 3.500 μM .

• Experimental Protocol for TMZ Sensitivity Testing:

  • Transfect cells with VAT1 siRNA or control siRNA

  • After 48 hours, treat cells with varying concentrations of TMZ

  • Measure cell viability using appropriate assays (e.g., MTT, CCK-8)

  • Calculate and compare IC50 values and inhibition ratios at equivalent drug concentrations

• Gene Expression Profiling: Analyze changes in drug resistance-related genes following VAT1 modulation.

• Pathway Analysis: Investigate how VAT1 affects known drug resistance pathways, including DNA repair mechanisms relevant to TMZ resistance.

• Patient Correlation Studies: Correlate VAT1 expression levels with treatment response and progression-free survival in patient cohorts receiving standard therapy.

What are the most promising therapeutic approaches targeting VAT1?

Based on current evidence, several therapeutic approaches targeting VAT1 show promise:

• RNA Interference: siRNA-mediated VAT1 knockdown has demonstrated significant anti-tumor effects in vitro, suggesting potential for RNA-based therapeutics .

• MicroRNA-based Approaches: Since miR-218 suppresses VAT1 expression, miR-218 mimics could be explored as potential therapeutic agents .

• Small Molecule VAT1 Inhibitors: Development of selective VAT1 inhibitors based on natural products like EGCg or synthetic compounds could provide new therapeutic options .

• Combination Therapies: Targeting VAT1 in combination with standard chemotherapy (e.g., TMZ) could enhance treatment efficacy, as VAT1 knockdown improves TMZ sensitivity .

• Immunotherapeutic Approaches: Given VAT1's potential role in tumor immunity, combining VAT1 inhibition with immunotherapies might yield synergistic effects .

For any therapeutic development program, researchers should systematically evaluate target engagement, efficacy in relevant preclinical models, potential off-target effects, and impacts on normal physiological functions where VAT1 plays important roles.

What are critical gaps in our understanding of VAT1 biology?

Despite significant progress, several critical knowledge gaps remain in VAT1 biology that warrant further investigation:

• Structural Characterization: Detailed structural information about VAT1, particularly regarding its transmembrane domains and active sites, is limited.

• Physiological Substrates: While VAT1 is implicated in monoamine transport, comprehensive identification of its physiological substrates and their transport kinetics requires further study.

• Tissue-Specific Functions: The role of VAT1 in different tissues beyond neuronal contexts needs clarification, especially given its expression in epithelial tissues.

• Interaction Network: A comprehensive understanding of VAT1's protein-protein interaction network would provide valuable insights into its cellular functions.

• Mechanism in Tumorigenesis: The precise molecular mechanisms by which VAT1 promotes tumor growth, migration, and drug resistance remain to be fully elucidated.

• Immune Regulation: The detailed mechanisms of VAT1's interaction with the immune system, particularly its effects on T-cell function and dopamine regulation in immune cells, require deeper investigation .

Addressing these knowledge gaps will require interdisciplinary approaches combining structural biology, biochemistry, cell biology, immunology, and cancer biology.