WDR5 Human

What is WDR5 and what are its primary functions in human cells?

WDR5 (WD Repeat Domain 5) is a highly conserved WD40-repeat protein that serves as an essential component of the MLL (Mixed Lineage Leukemia) complex, which induces histone H3 lysine 4 (K4) methylation . This protein functions primarily as a scaffold molecule that facilitates the assembly of multiprotein complexes involved in chromatin regulation and gene expression. In human cells, WDR5 plays critical roles in:

• Histone methylation through its interaction with MLL complexes

• Transcriptional regulation via various binding partners

• Development and differentiation processes

• Disease progression, particularly in cancer contexts

The structural basis for WDR5's functionality lies in its WD40 repeats, which form a propeller-like structure that creates multiple protein interaction surfaces. The most characterized interaction occurs through the WDR5 Interaction (Win) motif, which is required for core complex assembly with SET1 family methyltransferases .

How can researchers effectively measure WDR5 expression in human tissue samples?

Methodological approaches for quantifying WDR5 expression in human tissues include:

• Quantitative RT-PCR: Using validated primers such as:

  • WDR5 forward: TGATGGTCTCTGTCGCATCT

  • WDR5 reverse: CTTCAGAGTGTTGTCCAGCG

• Western blotting: Using antibodies specific to human WDR5 with appropriate controls.

• Immunohistochemistry: Particularly useful for assessing tissue-specific expression patterns.

• RNA-Seq: For genome-wide transcriptional analysis, allowing comparison of WDR5 expression across different conditions.

When analyzing WDR5 expression data, researchers should employ statistical methods such as Student's t-test to determine the significance of differences between experimental conditions .

What protein complexes incorporate WDR5 in human cells and how can these interactions be studied?

WDR5 participates in several key protein complexes in human cells:

• MLL/SET1 methyltransferase complexes: WDR5 is an essential component required for H3K4 methylation activity .

• PRMT5 complexes: WDR5 interacts with protein arginine methyltransferase 5 (PRMT5), a known repressor of γ-globin gene expression .

• HDAC1-containing complexes: WDR5 interacts with histone deacetylase 1 (HDAC1) and the PHD domain-containing protein ING2 (inhibitor of growth) .

These interactions can be studied using:

• Co-immunoprecipitation (Co-IP): As demonstrated in structure-function analyses where WDR5 mutants were evaluated for their binding to KMT2A and RBBP5 .

• Affinity purification followed by mass spectrometry: To identify novel binding partners.

• Yeast two-hybrid screening: For initial identification of potential interactors.

• Bioluminescence resonance energy transfer (BRET) or fluorescence resonance energy transfer (FRET): For examining interactions in living cells.

How do Win motifs from different human SET1 family methyltransferases interact with WDR5?

The interaction between WDR5 and SET1 family methyltransferases occurs through a specialized WDR5 interaction (Win) motif. Key findings regarding these interactions include:

• Binding affinity variation: Win motifs from human SET1 family members interact with WDR5 with binding affinities ranging from 50 to 2800 nM, with MLL3 Win motif demonstrating the greatest affinity .

• Structural determinants: Crystallographic studies have revealed that subtle variations within the conserved Win motif sequence contribute to binding energy differences .

• Role of flanking residues: The amino acid four residues C-terminal to the conserved arginine (+4) accounts for the majority of binding energy differences through the presence or absence of additional hydrogen bonds with WDR5 residues .

• N-terminal contributions: Residues N-terminal to the Win motif adopt conformations that may further stabilize the bound state .

This differential binding may provide a mechanism for regulating the assembly and activity of distinct SET1 family complexes in human cells.

What is the specific role of WDR5 in histone H3K4 methylation?

WDR5 serves as a critical scaffold protein in the MLL/SET1 complexes that catalyze histone H3K4 methylation, with several key functions:

• Complex assembly: WDR5 is essential for proper assembly of the MLL complex through its interaction with the Win motif of MLL1 .

• H3K4me3 establishment: WDR5 is specifically required for generating tri-methylated H3K4 (H3K4me3) at promoter regions, as demonstrated at the γ-globin promoter in K562 cells .

• Reader recruitment: The H3K4me3 mark established with WDR5 assistance can recruit proteins containing PHD domains, such as ING2, which recognize this specific modification .

• Transcriptional consequences: Paradoxically, despite H3K4me3 typically being associated with active transcription, WDR5-dependent H3K4me3 can contribute to gene repression in specific contexts, such as γ-globin gene regulation .

How does WDR5 contribute to human globin gene regulation?

WDR5 plays a significant role in human globin gene regulation, particularly in silencing fetal globin gene expression:

• Repression of γ-globin: Enforced expression of WDR5 in K562 cells reduces γ-globin gene expression, whereas knockdown of WDR5 increases γ-globin gene expression in both K562 cells and primary human bone marrow erythroid progenitor cells .

• Developmental regulation: In human bone marrow cells (BMC), WDR5 is highly enriched on the γ-promoter relative to other globin promoters and compared to the γ-promoter in cord blood erythroid progenitors, suggesting its importance in developmental globin gene switching .

• Repressive complex formation: WDR5 interacts with PRMT5, HDAC1, and ING2 to form a repressive complex at the γ-globin promoter .

• Chromatin modification changes: WDR5 knockdown leads to increased histone H3 and H4 acetylation at the γ-globin promoter, while histone H4R3 and H3K9 methylation are decreased .

A proposed mechanism suggests that WDR5 binds the γ-globin promoter in a PRMT5-dependent manner, and the H3K4me3 induced by WDR5 results in recruitment of the ING2-associated HDAC1 component, leading to silencing of γ-globin gene expression .

What roles does WDR5 play in human breast cancer progression?

WDR5 has been identified as a key regulator in breast cancer, particularly in triple-negative breast cancer (TNBC):

• Growth regulation: In vivo screening has identified WDR5 as a key regulator of breast cancer cell growth .

• Metastatic potential: WDR5 promotes metastatic colonization, particularly to the lung, which is the most frequent site of distant relapse in TNBC patients .

• RP gene expression: WDR5 regulates ribosomal protein (RP) gene expression and global protein translation independently of the KMT2 complex .

• Therapeutic implications: WDR5 inhibition or degradation has been suggested as a therapeutic approach for TNBC, potentially in combination with mTOR inhibitors for significant therapeutic benefit .

What experimental models are available for studying WDR5 function in human cancer?

Researchers investigating WDR5 in human cancer contexts can utilize several experimental models:

• Cell line models:

  • LM2 cells: Derived from MDA-MB-231 TNBC cells, these reproducibly generate lung metastasis and have been used in WDR5 functional studies .

  • K562 cells: Human erythroleukemia cell line useful for studying WDR5's role in hematopoietic contexts .

• Primary cell models:

  • Human bone marrow erythroid progenitor cells: Provide a physiologically relevant context for studying WDR5's role in normal hematopoiesis and globin gene regulation .

• Genetic manipulation approaches:

  • Inducible shRNA systems: Such as the doxycycline-inducible pINDUCER10 lentivirus system used for WDR5 knockdown .

  • Expression of WDR5 mutants: Including F133A, N25A, V268E mutations that affect specific protein interactions .

• In vivo models:

  • Xenograft models: For assessing tumor growth and metastasis following WDR5 manipulation .

How can structure-function relationships of WDR5 be effectively analyzed?

Researchers investigating structure-function relationships of WDR5 can employ several advanced techniques:

• Crystallographic analysis: Utilizing protein crystal structures such as 2H14 (apo-WDR5) from the Protein Data Bank, visualized using software like PyMol .

• Mutational analysis: Creating specific mutations based on structural information:

  • F133A mutation: Affects the WIN site and abrogates binding to KMT2A

  • N225A and V268E mutations: Reduce binding to RBBP5 by more than 50%

• Functional rescue experiments: Expressing shRNA-resistant wild-type or mutant WDR5 constructs in knockdown cells to determine which interactions are essential for specific functions .

• Colony formation assays: Quantifying growth effects of WDR5 mutations to correlate structure with function .

What methods are recommended for studying WDR5-dependent chromatin modifications?

To investigate WDR5's role in chromatin modifications, researchers should consider:

• Chromatin Immunoprecipitation (ChIP): For analyzing histone modifications and WDR5 occupancy at specific genomic loci, such as the γ-globin promoter .

• ChIP-seq: For genome-wide analysis of WDR5 binding sites and associated histone modifications.

• RNA-seq: For comprehensive analysis of transcriptional changes following WDR5 manipulation, with data deposited in repositories such as the NCBI Gene Expression Omnibus database .

• Western blotting: For global assessment of histone modification levels following WDR5 knockdown or overexpression.

• Quantitative RT-PCR: For targeted analysis of gene expression changes, using plasmid DNA encoding target genes (e.g., γ-globin or β-globin) to generate standard curves for determination of copy number .

How can WDR5 be targeted therapeutically in human cancers?

Based on recent research, several approaches for targeting WDR5 in cancer therapy are being explored:

• WDR5 inhibition: Direct inhibition of WDR5 functions has been shown to affect cancer cell growth, particularly in TNBC .

• WDR5 degradation: Targeted protein degradation approaches may provide another strategy for eliminating WDR5 activity in cancer cells .

• Combination therapy: WDR5 targeting could be combined with mTOR inhibitors to achieve significant therapeutic benefit, as suggested by synergistic effects observed in preclinical models .

• WIN site targeting: Small molecules targeting the WIN site might disrupt specific WDR5 interactions while preserving others, potentially allowing for selective modulation of WDR5 functions .

What methods can be used to evaluate drug synergy in WDR5-targeted therapies?

When assessing combination therapies targeting WDR5, researchers can employ the coefficient of drug interaction (CDI) method:

CDI = AB/(A×B)

Where:

• AB is the ratio of the combination group to the control group

• A or B is the ratio of the single agent group to the control group

Interpretation:

• CDI < 1: Drugs are synergistic

• CDI = 1: Drugs are additive

• CDI > 1: Drugs are antagonistic

• CDI < 0.7: Significant synergistic effect

This methodology has been successfully applied in studies evaluating WDR5-targeted therapies in combination with other agents, providing a quantitative framework for assessing therapeutic potential.