WISP2 Antibody，FITC conjugated

What is WISP2 protein and what biological functions does it regulate?

WISP2 (WNT1-inducible-signaling pathway protein 2), also known as CCN5, is a secreted matricellular protein that belongs to the CCN family. It functions as a regulatory protein in multiple biological processes including:

• Modulation of bone turnover by promoting adhesion of osteoblast cells

• Inhibition of fibrinogen binding to integrin receptors

• Regulation of osteocalcin production

• Cell proliferation, migration, wound healing, and angiogenesis

• Signaling pathway modulation, particularly in the WNT pathway

WISP2 has context-dependent roles in cancer development, where it can act as either a tumor promoter or suppressor depending on the cancer type. In ovarian cancer, WISP2 has been shown to promote cell proliferation via targeting ERK and YAP signaling pathways , while in acute myeloid leukemia (AML), it appears to have tumor suppressor properties .

What are the recommended storage conditions for WISP2 Antibody, FITC conjugated?

For optimal antibody performance and stability:

• Store at -20°C or -80°C upon receipt

• Avoid repeated freeze-thaw cycles as this may lead to protein denaturation and loss of antibody activity

• The antibody is typically provided in a storage buffer containing 50% glycerol, 0.01M PBS (pH 7.4), and 0.03% Proclin 300 as a preservative

• For short-term storage (less than one week), 4°C is acceptable if the antibody will be used soon

Research has shown that proper storage maintains antibody stability for up to 12 months at -20°C for similar antibody preparations .

What are the validated applications for WISP2 Antibody, FITC conjugated?

Based on the product information and related research:

• ELISA is specifically validated for the FITC-conjugated version

• For non-conjugated versions of WISP2 antibodies, applications include:

  • Western Blot (WB)

  • Immunohistochemistry on paraffin-embedded tissues (IHC-P)

  • Immunofluorescence/Immunocytochemistry (IF/ICC)

The FITC conjugation makes this antibody particularly suitable for applications requiring fluorescent detection. While the FITC-conjugated version is primarily validated for ELISA, researchers should conduct preliminary validation when applying to other fluorescence-based methods.

What controls should be included when using WISP2 Antibody, FITC conjugated?

A robust experimental design should include the following controls:

Positive Controls:

• Known WISP2-expressing cell lines (based on the literature):

  • Ovarian cancer cell lines ES-2 and HO8910

  • A549 and A431 cell extracts (previously validated)

  • Mouse ovary tissue

Negative Controls:

• Isotype control (rabbit IgG, FITC-conjugated) to assess non-specific binding

• WISP2 knockout/knockdown cells generated via CRISPR/Cas9

• Cells with naturally low WISP2 expression (normal ovary tissue has been shown to have weak expression)

Blocking Controls:

• Pre-incubation with recombinant WISP2 protein (24-250AA) should block specific binding

• Peptide competition assay using the immunogen

Technical Controls:

• Unstained samples to determine autofluorescence

• Secondary antibody-only controls (for multi-step detection protocols)

How can WISP2 Antibody, FITC conjugated be used to study WISP2's role in cancer progression?

To investigate WISP2's role in cancer progression using this antibody:

Expression Analysis:

• Compare WISP2 expression levels between normal and cancer tissues using immunofluorescence microscopy

• Correlate WISP2 expression with clinical outcomes in patient samples

Functional Studies:

• Generate WISP2 knockout cell lines using CRISPR/Cas9:

  • Use the sgRNA sequences validated in previous studies:

    • Wisp2-1: GCTGTGAGGTGAATGGCCGC

    • Wisp2-2: TTGCCGGCTGCATCACTGCC

  • Confirm knockout efficiency using the FITC-conjugated antibody

• Assess phenotypic changes in WISP2-knockout cells:

  • Cell proliferation using CCK-8 assay

  • Clone formation via soft agar colony formation assay

  • Cell migration using scratch wound assay and transwell migration assay

  • Apoptosis using TUNEL staining

• Signaling pathway analysis:

  • Investigate ERK pathway alterations (p-ERK1/2)

  • Examine YAP activation and related target genes (Ankrd, Amotl2, c-Myc)

  • Study EMT markers (E-cadherin, Snail, MMP-13)

What are the methodological approaches to study WISP2 acetylation using this antibody?

To investigate WISP2 acetylation:

Detection of Acetylated WISP2:

• Co-immunoprecipitation approach:

  • Immunoprecipitate WISP2 using the FITC-conjugated antibody

  • Probe with anti-acetyl lysine antibodies in western blot

  • Alternatively, immunoprecipitate using anti-acetyl lysine antibodies and detect WISP2

• Pharmacological manipulation:

  • Treat cells with HDAC inhibitors:

    • Pan-HDAC inhibitors: valproic acid (VPA, 0.5-2 mM) or trichostatin A (TSA, 2.5-10 μM)

    • HDAC3-specific inhibitor: RGFP966

  • Assess changes in WISP2 acetylation levels

Site-Specific Acetylation Analysis:

• Generate lysine-to-arginine mutants:

  • Focus on lysine K6 and K20 residues (identified as potential acetylation sites)

  • Create WISP2_K6R and WISP2_K20R constructs

  • Express in appropriate cell systems

• Stability analysis:

  • Treat cells with cycloheximide to block protein synthesis

  • Monitor WISP2 degradation over time (1-24 hours)

  • Compare stability between wildtype and acetylation site mutants

How does WISP2 interact with ERK signaling pathways in cancer models?

Research indicates an important relationship between WISP2 and ERK signaling:

Pathway Interaction:

• WISP2 deletion significantly suppresses phosphorylated ERK1/2 (p-ERK1/2) in ovarian cancer cells

• This inhibition affects downstream targets including:

  • CCAAT/enhancer-binding protein α (CEBPα)

  • CEBPβ

  • ELK-1

  • p90RSK

Experimental Approach to Study This Interaction:

• Compare p-ERK1/2 levels between wild-type and WISP2-knockout cells using western blot

  Antibody	Source	Identifier
  ERK1/2	Cell Signaling	Cat#:4695
  p-ERK1/2	Cell Signaling	Cat#:4370
  WISP2	Abcam	Cat#:31317

• Conduct rescue experiments:

  • Re-express WISP2 in knockout cells

  • Assess restoration of p-ERK1/2 levels

• ERK pathway manipulation:

  • Use ERK inhibitors (e.g., PD98059) in WISP2-expressing cells

  • Test if ERK inhibition mimics WISP2 deletion phenotypes

• Investigate crosstalk with other pathways:

  • WISP2 deletion also activates Yes-associated protein (YAP)

  • Use YAP inhibitors to determine if YAP activation compensates for ERK inhibition

How can WISP2 Antibody, FITC conjugated be used in conjunction with CRISPR/Cas9 for functional studies?

The combination of CRISPR/Cas9 genome editing and WISP2 antibody detection provides powerful insights into WISP2 function:

CRISPR/Cas9 Knockout Strategy:

• Design sgRNAs targeting WISP2:

• Transfection and selection:

  • Transfect cells with CRISPR/Cas9 plasmids

  • Enrich transfected cells with puromycin selection (3 days)

  • Single-cell sort to 96-well plates

  • Screen clones using western blot with WISP2 antibody

Verification and Analysis:

• Confirm knockout efficiency:

  • Use FITC-conjugated WISP2 antibody for flow cytometry

  • Perform western blot or immunofluorescence microscopy

• Functional assays with knockout cells:

  • Cell growth assay to measure proliferation rates

  • Soft agar assay to assess anchorage-independent growth

  • Scratch wound and transwell assays for migration analysis

• In vivo studies:

  • Track GFP-expressing WISP2-modified cells in animal models

  • Monitor effects on:

    • Tissue repair (e.g., liver regeneration)

    • Tumor development

    • Metastasis

What methodologies can detect post-translational modifications of WISP2?

Post-translational modifications (PTMs) of WISP2, particularly acetylation and ubiquitination, play critical roles in regulating its stability and function:

Acetylation Analysis:

• Co-immunoprecipitation approach:

  • Lyse cells with RIPA buffer

  • Immunoprecipitate with anti-WISP2 antibody

  • Detect with anti-acetyl lysine antibody

• Site-specific analysis:

  • Focus on lysine K6 and K20 residues

  • Create K→R mutants (WISP2_K6R and WISP2_K20R)

  • Express in cell systems and assess acetylation levels

• HDAC inhibitor treatment:

  • Valproic acid (0.5-2 mM)

  • Trichostatin A (2.5-10 μM)

  • RGFP966 (HDAC3-specific inhibitor)

Ubiquitination Analysis:

• Ubiquitination assay:

  • Treat cells with MG132 proteasome inhibitor (10 μM, 6 hours)

  • Immunoprecipitate WISP2

  • Detect ubiquitination with anti-ubiquitin antibody

• Stability assessment:

  • Cycloheximide chase assay:

    • Treat cells with cycloheximide

    • Harvest at different time points (1-24 hours)

    • Analyze WISP2 protein degradation by western blot

What are common issues with FITC-conjugated antibodies and how can they be resolved?

Issue: Photobleaching

• Solution: Minimize exposure to light during handling and storage

• Use anti-fade mounting media for microscopy applications

• Consider taking images of control samples first to establish optimal exposure settings

Issue: Background Fluorescence

• Solution: Include proper blocking steps (1-5% BSA or serum)

• Optimize antibody dilution (start with manufacturer's recommendation)

• Use appropriate negative controls

• Consider autofluorescence quenching reagents

Issue: Low Signal-to-Noise Ratio

• Solution: Optimize fixation protocol (test different fixatives: PFA, methanol)

• Adjust permeabilization conditions if detecting intracellular epitopes

• Increase antibody concentration gradually

• Extend incubation time at 4°C

Issue: Non-Specific Binding

• Solution: Include isotype control

• Add 0.1-0.3% Triton X-100 in blocking buffer

• Pre-adsorb antibody with cell/tissue lysates from irrelevant species

How can researchers validate the specificity of WISP2 Antibody, FITC conjugated?

To ensure antibody specificity:

1. Genetic Validation:

• Test in WISP2 knockout cells generated by CRISPR/Cas9

• Use siRNA or shRNA knockdown of WISP2

• Compare signal between tissues/cells with known high versus low expression

2. Peptide Competition:

• Pre-incubate antibody with excess immunizing peptide (recombinant WISP2 protein 24-250AA)

• Compare signals with and without peptide competition

3. Cross-Reactivity Testing:

• Test against cell lines from non-target species

• Since this antibody is specifically reactive to human WISP2 , use non-human cells as negative controls

4. Orthogonal Methods:

• Correlate results with other WISP2 antibodies targeting different epitopes

• Validate findings using orthogonal techniques (qPCR, ELISA)

• Use multiple application methods (if compatible beyond ELISA)

5. Western Blot Validation:

• If performing western blot with a non-FITC version, confirm the band appears at the expected molecular weight (27 kDa, with potential secondary band at 41 kDa)

• Perform the blot in cells with known WISP2 expression profiles