WNT5A Antibody, HRP conjugated

What is WNT5A and what biological functions does it serve?

WNT5A is a noncanonical member of the Wnt family of signaling molecules involved in various physiological and pathological processes. It functions as a ligand for members of the frizzled family of seven transmembrane receptors and can either activate or inhibit canonical Wnt signaling depending on receptor context. In the presence of FZD4, WNT5A activates beta-catenin signaling, while with ROR2, it inhibits the canonical Wnt pathway by promoting beta-catenin degradation through a GSK3-independent pathway . This versatility allows WNT5A to participate in diverse cellular functions including cell differentiation, migration, growth regulation, vascular remodeling, and it has been implicated in both cancer development and chronic inflammatory processes . During embryogenesis, WNT5A is required for extension of the primary anterior-posterior axis and for outgrowth of limbs and the genital tubercle . In cancer biology, WNT5A can act as a tumor suppressor by decreasing proliferation, migration, invasiveness, and clonogenicity of carcinoma cells, while simultaneously mediating motility in melanoma cells .

How do HRP-conjugated antibodies function in experimental research applications?

HRP (Horseradish Peroxidase)-conjugated antibodies function as powerful detection tools in various immunoassays by combining the specificity of antibody binding with the enzymatic activity of HRP. When the antibody binds to its target antigen (WNT5A in this case), the attached HRP enzyme can catalyze a colorimetric, chemiluminescent, or fluorescent reaction when appropriate substrates are introduced. This reaction produces a measurable signal proportional to the amount of target protein present. HRP conjugation eliminates the need for a secondary antibody step in many applications, simplifying protocols and potentially reducing background noise . For instance, in Western blot applications, the HRP-conjugated WNT5A antibody directly produces a signal when exposed to enhanced chemiluminescence (ECL) substrate, allowing visualization of the WNT5A protein band at approximately 42 kDa under reducing conditions . Similarly, in immunohistochemistry applications, the HRP-conjugated antibody enables direct visualization of WNT5A in tissue sections when used with appropriate substrates like DAB (3,3'-diaminobenzidine), which produces a brown precipitate at sites of WNT5A expression .

What are the different types of WNT5A antibodies available for research?

Research literature identifies several types of WNT5A antibodies that vary in host species, clonality, and applications:

Research has demonstrated that polyclonal antibodies like AF645 may be more suitable for Western blot applications, while monoclonal antibodies such as 3A4 might perform better in immunohistochemistry . The selection of an appropriate antibody should be guided by the specific experimental design, target species, and application requirements. The HRP-conjugated polyclonal antibody (bs-1948R-HRP) offers versatility across multiple applications including Western blot, ELISA, and immunohistochemistry, with reactivity against human, mouse, rat, and dog WNT5A .

What are the recommended protocols for using WNT5A antibodies in Western blot applications?

For optimal results in Western blot applications using WNT5A antibodies, the following methodological approach is recommended:

• Sample Preparation: Prepare lysates from relevant tissues (e.g., HeLa cells, mouse brain embryo E14) under reducing conditions .

• Electrophoresis: Separate proteins on an SDS-PAGE gel using appropriate buffer systems such as Western Blot Buffer Group 1 .

• Transfer: Transfer proteins to a PVDF membrane following standard laboratory protocols.

• Blocking: Block the membrane with an appropriate blocking buffer (typically containing BSA or non-fat milk).

• Primary Antibody Incubation: For HRP-conjugated WNT5A antibody (bs-1948R-HRP), use a dilution range of 1:300-5000 . For non-conjugated antibodies like AF645, use 2 μg/mL .

• Washing: Wash thoroughly with TBST (TBS containing 0.05-0.1% Tween-20).

• Secondary Antibody (if using non-conjugated primary): For AF645, use HRP-conjugated Anti-Goat IgG Secondary Antibody (e.g., HAF017) . This step is not needed for HRP-conjugated primary antibodies.

• Detection: Apply appropriate substrate and detect the signal. WNT5A typically appears as a band at approximately 42 kDa .

• Controls: Include positive controls (tissues known to express WNT5A) and negative controls to validate results.

When interpreting results, be aware that different antibodies may have different sensitivities and specificities. The AF645 antibody has been validated to detect WNT5A in Western blots, while some other WNT5A antibodies may not perform as well in this application .

How can I develop and optimize a sandwich ELISA for WNT5A detection?

Developing a sandwich ELISA for WNT5A requires careful optimization of antibody pairs and buffer conditions. Based on the research literature, the following methodology is recommended:

• Capture Antibody Selection: Use rabbit anti-human WNT5A as a capture antibody, coating a 96-well plate with 50 μL of the antibody solution and incubating overnight at 4°C .

• Blocking: Wash the plate twice with washing buffer and block non-specific binding sites.

• Detection System Options:

  • Option 1: Use goat anti-mouse WNT5A as detection antibody and HRP-conjugated F(ab')2 donkey anti-goat IgG as the enzyme-linked antibody .

  • Option 2: Use biotinylated goat anti-mouse WNT5A and HRP-streptavidin as detection antibody and enzyme-linked avidin respectively .

• Buffer Optimization: Standard buffers like HBBS+ (Hank's balanced salt solution with Ca2+ and Mg2+) with 1% BSA may not be optimal for WNT5A detection. Adding polyethylene glycol (PEG) to the buffer during the binding stage of recombinant mouse (rm)-WNT5A significantly improves detection sensitivity .

• Maximum Signal Optimization: Using PEG during both the binding of rm-WNT5A and detection antibody stages yields the maximum signal for rm-WNT5A detection .

• Validation: Establish a standard curve to determine the linear detection range. Research has shown that the relationship between ELISA signal and WNT5A concentration can be linear with an R² of 0.9934 .

• Cross-reactivity Consideration: Be aware of potential cross-reactivity between antibodies. Research shows that goat anti-mouse WNT5A shows limited cross-reactivity with rabbit anti-human WNT5A when the latter is adsorbed to the plate, but rabbit anti-human WNT5A used as a detection antibody does cross-react with goat anti-mouse WNT5A used as the capture antibody .

This methodological approach allows for the development of a sensitive and specific sandwich ELISA for WNT5A detection in research settings.

What are the optimal conditions for immunohistochemistry using WNT5A antibodies?

For optimal immunohistochemistry (IHC) detection of WNT5A, consider the following methodological recommendations based on published research:

• Tissue Preparation Options:

  • Paraffin-embedded sections: For WNT5A Polyclonal Antibody, HRP Conjugated (bs-1948R-HRP), use at a dilution of 1:200-400 .

  • Frozen sections: Use at a dilution of 1:100-500 for HRP-conjugated antibodies .

• Protocol for Paraffin Sections:

  • Fix tissues appropriately (immersion fixed)

  • Embed in paraffin and section

  • For Mouse/Rat WNT5A Antibody (AF645), use at 15 μg/mL

  • Incubate overnight at 4°C

  • Use appropriate detection system (e.g., Anti-Goat HRP-DAB Cell & Tissue Staining Kit)

  • Counterstain with hematoxylin

• Protocol for Frozen Sections:

  • Fix tissues by immersion

  • Section frozen tissue

  • Incubate with WNT5A antibody (e.g., AF645 at 15 μg/mL) overnight at 4°C

  • Detect using an appropriate system (e.g., Anti-Goat HRP-DAB Cell & Tissue Staining Kit)

  • Counterstain with hematoxylin

• Antibody Selection: Research indicates that the monoclonal 3A4 antibody may be most appropriate for IHC applications, while the polyclonal AF645 antibody is better suited for Western blot analysis .

• Controls: Include positive control tissues known to express WNT5A (e.g., mouse embryonic rib, mouse embryo) . Negative controls should omit the primary antibody.

• Signal Development: For HRP-conjugated antibodies, develop using appropriate substrates like DAB, which produces a brown precipitate at sites of WNT5A expression.

• Validation: Confirm specificity through pre-absorption tests with recombinant WNT5A protein .

These methodological considerations should help researchers achieve optimal results when detecting WNT5A in tissue sections using immunohistochemistry techniques.

How can I validate the specificity of my WNT5A antibody?

Validating antibody specificity is critical for ensuring reliable experimental results. For WNT5A antibodies, consider implementing the following validation strategies:

• Pre-absorption Tests: Conduct pre-absorption tests with recombinant WNT5A protein to confirm specific binding. Research has demonstrated that antibodies like AF645 and 3A4 specifically detect WNT5A in different assays when subjected to pre-absorption testing .

• Positive and Negative Control Samples: Include tissues or cell lines known to express high levels of WNT5A (positive controls) and those with minimal expression (negative controls). Mouse embryonic tissues, particularly rib and embryo sections, serve as excellent positive controls for WNT5A expression .

• Western Blot Validation: Confirm antibody specificity by Western blot, looking for a single band at the expected molecular weight (approximately 42 kDa for WNT5A) . Multiple bands may indicate non-specific binding or post-translational modifications.

• PCR Correlation: Correlate protein detection with mRNA expression by performing RT-PCR for WNT5A. Primers such as 5′GTGCAATGTCTTCCAAGTTCTTC 3′ (forward) and 5′GGCACAGTTTCTTCTGTCCTTG 3′ (reverse) can be used for WNT5A PCR (product size: 195 base pairs) .

• In Situ Hybridization Correlation: Perform in situ hybridization using WNT5A-specific probes (e.g., mouse WNT5A entire coding region) and compare the expression pattern with immunohistochemistry results .

• Knockout/Knockdown Validation: If possible, use WNT5A knockout or knockdown models to confirm antibody specificity. The absence or reduction of signal in these models strongly supports antibody specificity.

• Comparative Analysis of Multiple Antibodies: Test multiple antibodies targeting different epitopes of WNT5A and compare their detection patterns. Research has shown that different WNT5A antibodies may perform optimally in different applications .

By implementing these rigorous validation strategies, researchers can confidently establish the specificity of their WNT5A antibodies and ensure reliable experimental outcomes.

What are the best practices for troubleshooting cross-reactivity issues with WNT5A antibodies?

Cross-reactivity can significantly compromise experimental results when working with WNT5A antibodies. To address this issue effectively, consider the following troubleshooting strategies:

• Epitope Analysis: Review the immunogen information for your antibody. The bs-1948R-HRP antibody, for example, is derived from a synthetic peptide within the 301-381/381 range of human WNT5A . Understanding the specific epitope can help predict potential cross-reactivity with similar proteins.

• Antibody Pairing in Sandwich Assays: Be aware that certain antibody combinations may exhibit cross-reactivity. Research has shown that while goat anti-mouse WNT5A shows limited cross-reactivity with rabbit anti-human WNT5A adsorbed to plates, rabbit anti-human WNT5A used as a detection antibody does cross-react with goat anti-mouse WNT5A used as a capture antibody . This suggests that complementary binding sites may exist between these antibodies.

• Cross-Species Reactivity Assessment: Explicitly test your antibody against WNT5A from different species. The bs-1948R-HRP antibody shows reactivity with human, mouse, rat, and dog WNT5A, with predicted reactivity to cow, pig, and rabbit WNT5A .

• Buffer Optimization: Adjust blocking buffers and additives to minimize non-specific binding. Consider using specialized blocking agents or increasing the concentration of blocking proteins (BSA, non-fat milk) in your buffer.

• Titration Experiments: Perform antibody dilution series to identify the optimal concentration that maximizes specific signal while minimizing background. For bs-1948R-HRP, recommended dilutions vary by application: 1:300-5000 for Western blot, 1:500-1000 for ELISA, 1:200-400 for IHC-P, and 1:100-500 for IHC-F .

• Pre-absorption Controls: Conduct pre-absorption experiments with recombinant WNT5A and closely related proteins (e.g., WNT5B) to assess specificity and cross-reactivity. This approach has successfully identified antibodies like AF645 and 3A4 that specifically detect WNT5A .

• Distinguish Between WNT5A and WNT5B: Since WNT5A and WNT5B share sequence homology, use specific PCR primers to distinguish between them (WNT5A: 5′GTGCAATGTCTTCCAAGTTCTTC 3′ forward and 5′GGCACAGTTTCTTCTGTCCTTG 3′ reverse; WNT5B: 5′GACGCCAACTCCTGGTGGC 3′ forward and 5′GCATGACTCTCCCAAAGACAGATG 3′ reverse) .

• Alternative Detection Methods: If persistent cross-reactivity occurs, consider orthogonal methods like in situ hybridization with WNT5A-specific probes to confirm expression patterns observed with antibody-based detection .

By systematically implementing these troubleshooting strategies, researchers can minimize cross-reactivity issues and enhance the specificity of WNT5A detection in their experimental systems.

How do storage conditions affect the stability and performance of HRP-conjugated WNT5A antibodies?

Proper storage of HRP-conjugated WNT5A antibodies is critical for maintaining their stability and performance over time. Based on manufacturer recommendations and research practices, the following guidelines should be followed:

• Temperature Requirements: Store HRP-conjugated WNT5A antibodies at -20°C for long-term stability. The bs-1948R-HRP antibody specifically requires storage at -20°C to maintain its functionality .

• Aliquoting Strategy: Divide the antibody solution into multiple small aliquots to avoid repeated freeze-thaw cycles, which can significantly degrade antibody performance. Each freeze-thaw cycle can reduce antibody activity and increase background in experimental applications .

• Buffer Composition: HRP-conjugated WNT5A antibodies are typically stored in specialized buffers containing stabilizing agents. The bs-1948R-HRP antibody, for instance, is maintained in an aqueous buffered solution containing 0.01M TBS (pH 7.4) with 1% BSA, 0.03% Proclin300, and 50% glycerol . These components serve specific functions:

  • BSA: Provides protein stability and prevents nonspecific binding

  • Glycerol (50%): Acts as a cryoprotectant and prevents freezing at -20°C

  • Proclin300: Functions as an antimicrobial preservative

• Working Solution Handling: When preparing working dilutions, use appropriate diluents that maintain antibody stability. For immunohistochemistry applications, dilute in buffers containing carrier proteins to prevent adsorption to tubes.

• Light Protection: HRP-conjugated antibodies should be protected from prolonged exposure to light, as light can degrade the HRP enzyme and reduce signal intensity in downstream applications.

• Stability Indicators: Monitor antibody performance over time by including positive controls in each experiment. A decline in signal intensity with consistent protocols may indicate antibody degradation.

• Reconstitution Practices: If the antibody is supplied in lyophilized form, reconstitute according to manufacturer's instructions and then create aliquots before freezing to avoid repeated freeze-thaw cycles.

Adhering to these storage guidelines will help ensure consistent performance of HRP-conjugated WNT5A antibodies across experiments and maximize their shelf life, providing more reliable and reproducible research outcomes.

How can I use WNT5A antibodies to investigate WNT5A's role in cell migration and proliferation?

WNT5A antibodies serve as valuable tools for investigating WNT5A's role in cell migration and proliferation through various methodological approaches:

• Endothelial Network Formation Assays:

  • Verify WNT5A overexpression by Western blot using WNT5A antibodies

  • Prepare Matrigels using 24-well plates with 0.3 ml Growth Factor-reduced Matrigel per well

  • Incubate plates at 37°C for 1 hour

  • Seed retrovirally selected cells (e.g., HUVEC expressing WNT5A-HA or control gene) at 100,000 cells per well

  • Culture in full endothelial cell medium

  • Document network formation at 18-19 hours with 4× magnification

  • Compare network formation between WNT5A-overexpressing and control cells

• Migration Assays:

  • Seed cells at confluence

  • Create a wound in the confluent monolayer 24 hours later

  • Document migration into the wounded area 10 hours post-wounding

  • Compare migration rates between WNT5A-expressing and control cells

  • This approach has demonstrated WNT5A's ability to stimulate cell migration

• Proliferation Analysis:

  • Use WNT5A antibodies in immunohistochemistry to identify WNT5A-expressing cells in tissue sections

  • Correlate WNT5A expression with proliferation markers

  • Quantify cell numbers in WNT5A-overexpressing versus control conditions

  • This approach helps elucidate WNT5A's context-dependent effects on proliferation

• Signaling Pathway Analysis:

  • Use WNT5A antibodies in combination with antibodies against downstream signaling molecules

  • Investigate WNT5A's interaction with frizzled receptors (e.g., FZD4) and co-receptors (e.g., ROR2)

  • Examine how WNT5A affects canonical versus non-canonical WNT signaling pathways

  • This helps understand how WNT5A can either promote beta-catenin signaling (with FZD4) or inhibit it (with ROR2)

• Gene Expression Profiling:

  • Compare gene expression patterns between WNT5A-overexpressing and control cells using microarray or RNA-seq

  • Validate expression changes of key genes with RT-PCR

  • WNT5A-specific gene signatures have been identified through GeneChip analysis, showing distinct patterns compared to WNT1 and control (LacZ) conditions

• MMP Activity Assays:

  • Measure activity levels of matrix metalloproteinases (e.g., MMP-1) in conditioned media of WNT5A-expressing cells

  • Use activity assays such as Biotrak Activity Assay to quantify MMP activity

  • This helps understand WNT5A's role in extracellular matrix remodeling during cell migration

These methodological approaches provide a comprehensive framework for investigating WNT5A's complex roles in regulating cell migration and proliferation across different cellular contexts.

What dilution ranges should be used for WNT5A antibodies in different experimental applications?

Optimal dilution ranges for WNT5A antibodies vary based on the specific antibody and application. The following table summarizes recommended dilutions for various experimental techniques based on published research:

When determining the optimal antibody dilution for a specific application, consider the following methodological guidelines:

• Antibody Titration: Perform an initial titration experiment using a range of dilutions bracketing the recommended range to determine the optimal concentration for your specific experimental system.

• Signal-to-Noise Ratio: Select the dilution that provides the highest specific signal while minimizing background or non-specific staining.

• Sample Type Considerations: Freshly isolated samples may require different antibody concentrations than cultured cells or archived tissues.

• Detection Method Sensitivity: More sensitive detection systems (e.g., enhanced chemiluminescence for Western blot) may allow for more dilute antibody concentrations.

• Incubation Conditions: Extended incubation times (e.g., overnight at 4°C) may permit more dilute antibody concentrations compared to shorter incubations at room temperature.

By carefully optimizing antibody dilutions for each experimental application, researchers can maximize specific detection of WNT5A while conserving valuable antibody resources.

How can I apply WNT5A antibodies to investigate canonical versus non-canonical WNT signaling pathways?

WNT5A antibodies provide powerful tools for distinguishing between canonical and non-canonical WNT signaling pathways in experimental systems. Here's a methodological approach to investigate these distinct signaling mechanisms:

• Receptor Context Analysis:

  • Use WNT5A antibodies in co-immunoprecipitation experiments to identify receptor interactions

  • Investigate WNT5A binding to FZD4 (associated with canonical signaling) versus ROR2 (associated with non-canonical signaling)

  • This approach helps understand how receptor context determines WNT5A's signaling output

• Beta-Catenin Pathway Assessment:

  • Monitor beta-catenin levels and cellular localization in the presence of WNT5A

  • In canonical signaling contexts (with FZD4), WNT5A activates beta-catenin signaling

  • In non-canonical contexts (with ROR2), WNT5A promotes beta-catenin degradation through a GSK3-independent pathway

  • This can be visualized using immunofluorescence with WNT5A and beta-catenin antibodies

• Signaling Pathway Component Analysis:

  • Use Western blot with phospho-specific antibodies to examine activation of:

    • Canonical pathway: LRP5/6 phosphorylation, GSK3β inhibition, β-catenin stabilization

    • Non-canonical pathways: JNK activation, CaMKII phosphorylation, PKC activation

  • Compare signaling responses in different cellular contexts to map WNT5A signaling networks

• Reporter Assays:

  • Employ TCF/LEF luciferase reporters to measure canonical WNT pathway activation

  • Observe how WNT5A affects reporter gene expression in different receptor contexts

  • WNT5A has been shown to down-regulate beta-catenin-induced reporter gene expression in the presence of ROR2

• Functional Outcome Analysis:

  • Correlate signaling pathway activity with functional outcomes:

    • Chondrogenesis: Non-canonical WNT5A signaling suppresses the canonical pathway to allow chondrogenesis

    • Cell migration: WNT5A stimulates migration through non-canonical pathways

    • Proliferation and tumor formation: WNT5A's inhibition of the canonical pathway can inhibit tumor formation

• Gene Expression Profiling:

  • Use microarray or RNA-seq to identify gene expression signatures associated with canonical versus non-canonical WNT5A signaling

  • Validate key differential genes using RT-PCR

  • Hierarchical clustering analysis of gene expression data has revealed distinct gene clusters associated with WNT5A versus canonical WNT1 signaling

• Target Gene Validation:

  • Examine expression of known canonical WNT target genes (e.g., cyclin D1, c-myc) versus non-canonical targets

  • Use ChIP assays to assess TCF/LEF binding to promoters in response to WNT5A in different contexts

By systematically applying these methodological approaches, researchers can delineate the complex dual role of WNT5A in modulating canonical and non-canonical WNT signaling pathways, providing insights into its context-dependent functions in development, homeostasis, and disease.

What are the common challenges in WNT5A detection and how can they be addressed?

Detecting WNT5A presents several technical challenges that researchers should be prepared to address. Here are the most common issues and their methodological solutions:

• Low Signal Intensity:

  • Challenge: WNT5A is often expressed at relatively low levels, making detection difficult.

  • Solution: Optimize buffer conditions by adding polyethylene glycol (PEG) during binding stages in ELISA assays, which has been shown to significantly improve WNT5A detection sensitivity . For Western blots, consider using enhanced chemiluminescence detection systems and longer exposure times.

• Background and Non-specific Binding:

  • Challenge: High background can mask specific WNT5A signals in immunoassays.

  • Solution: Implement rigorous blocking protocols using appropriate blocking buffers (e.g., 1% BSA in HBBS+ for ELISA) . For immunohistochemistry, use specialized blocking reagents to reduce endogenous peroxidase activity and non-specific binding.

• Cross-reactivity with Related Proteins:

  • Challenge: WNT family members share sequence homology, particularly WNT5A and WNT5B.

  • Solution: Validate antibody specificity through pre-absorption tests with recombinant WNT5A and related proteins . Use specific PCR primers to distinguish between WNT5A and WNT5B expression at the mRNA level .

• Post-translational Modifications:

  • Challenge: WNT5A undergoes lipid modifications and glycosylation that can affect antibody recognition.

  • Solution: Select antibodies raised against epitopes less likely to be affected by post-translational modifications. The bs-1948R-HRP antibody targets amino acids 301-381/381 of human WNT5A .

• Sample Preparation Issues:

  • Challenge: WNT5A protein can be lost during sample preparation due to its hydrophobic nature.

  • Solution: Use appropriate lysis buffers containing detergents compatible with WNT5A extraction. For Western blot, specific buffer systems like Western Blot Buffer Group 1 have been successfully used with WNT5A detection .

• Antibody Selection:

  • Challenge: Different antibodies perform optimally in different applications.

  • Solution: Use application-specific antibodies based on validated research: the monoclonal 3A4 antibody for IHC and the polyclonal AF645 antibody for Western blot analysis .

• Detection in Complex Matrices:

  • Challenge: Detecting WNT5A in complex biological fluids or tissue extracts.

  • Solution: Implement sandwich ELISA approaches with optimized antibody pairs and buffer conditions. Adding PEG during both binding and detection antibody stages can maximize signal .

• Reproducibility Issues:

  • Challenge: Variability between experiments affecting consistent WNT5A detection.

  • Solution: Standardize protocols, include internal controls in each experiment, and prepare single-use aliquots of antibodies to avoid freeze-thaw cycles that can degrade performance .

By anticipating these common challenges and implementing the recommended methodological solutions, researchers can significantly improve the reliability and sensitivity of WNT5A detection across various experimental platforms.

How should I select appropriate controls for WNT5A antibody validation?

Selecting appropriate controls is essential for validating WNT5A antibody specificity and ensuring reliable experimental results. Here's a comprehensive approach to control selection:

• Positive Tissue Controls:

  • Embryonic Tissues: Mouse embryonic rib and whole mouse embryo sections have been validated as positive controls for WNT5A expression .

  • Cell Lines: HeLa human cervical epithelial carcinoma cells and mouse brain embryo (E14) lysates have shown detectable WNT5A expression in Western blot analyses .

  • Method: Process these positive control samples alongside experimental samples using identical protocols to confirm antibody performance.

• Negative Controls:

  • Primary Antibody Omission: Process tissue sections or cells without adding the primary WNT5A antibody to assess potential non-specific binding of secondary detection systems.

  • Isotype Controls: Use matched isotype control antibodies (e.g., normal rabbit IgG for rabbit polyclonal WNT5A antibodies) at the same concentration to evaluate non-specific binding.

  • Low-Expression Tissues: Include tissues known to express minimal WNT5A as biological negative controls.

• Pre-absorption Controls:

  • Methodology: Pre-incubate the WNT5A antibody with excess recombinant WNT5A protein before application to samples.

  • Interpretation: Specific antibody binding should be significantly reduced or eliminated after pre-absorption with the target antigen.

  • Validation: This approach has successfully identified specific WNT5A antibodies such as AF645 and 3A4 .

• Genetic Controls:

  • Knockdown/Knockout Systems: Use siRNA, shRNA, or CRISPR/Cas9 to reduce or eliminate WNT5A expression in cell lines or model organisms.

  • Overexpression Systems: Compare WNT5A detection in wild-type versus WNT5A-overexpressing cells (e.g., retrovirally selected HUVEC expressing WNT5A-HA) .

  • Interpretation: Signal intensity should correlate with genetic manipulation of WNT5A expression levels.

• Cross-Validation with Orthogonal Methods:

  • mRNA Detection: Correlate protein detection with WNT5A mRNA expression using RT-PCR or in situ hybridization.

  • PCR Primers: 5′GTGCAATGTCTTCCAAGTTCTTC 3′ (forward) and 5′GGCACAGTTTCTTCTGTCCTTG 3′ (reverse) for WNT5A .

  • In Situ Probes: Use mouse WNT5A entire coding region for in situ hybridization .

• Multiple Antibody Validation:

  • Complementary Epitopes: Use multiple antibodies targeting different epitopes of WNT5A to confirm detection patterns.

  • Compare Performance: Different antibodies may perform optimally in different applications (e.g., AF645 for Western blot, 3A4 for IHC) .

• Concentration Controls:

  • Antibody Titration: Perform serial dilutions of the antibody to identify the optimal concentration that maximizes specific signal while minimizing background.

  • Recommended Ranges: Follow application-specific dilution guidelines (e.g., 1:300-5000 for Western blot with bs-1948R-HRP) .

Implementing this comprehensive control strategy will significantly enhance the rigor and reliability of WNT5A antibody validation, providing a solid foundation for subsequent experimental applications.