YBL094C Antibody

Shipped with Ice Packs
In Stock

Description

YBL094C Gene Overview

YBL094C is a non-essential yeast gene located on chromosome II. While its exact molecular role is not fully characterized, it has been studied in genetic deletion experiments and transcriptional analyses. Key features include:

Gene AttributeDetails
Chromosomal LocationChromosome II (YBL094C)
ORF Deletion ConstructReplaced with hygromycin (HYG) or kanamycin (KanMX) markers via PCR
Primer Sequences (5′→3′)Forward: GAAGATGCACCATGTCTTATTCAGT; Reverse: Not explicitly listed
Associated ProteinsWeak similarity to Legionella small basic protein sbpA

Antibody Applications in YBL094C Research

While no antibody directly targeting YBL094C is documented, related studies employ antibodies for:

Gene Deletion Validation

  • Method: Strains with YBL094C deletions are constructed using PCR-amplified DNA fragments. Antibodies like anti-Htz1 (used in ChIP assays) or secondary antibodies (e.g., Alexa 555-conjugated goat anti-rabbit IgG) validate protein interactions or confirm gene knockouts .

  • Example Workflow:

    1. Transform yeast with YBL094C deletion cassettes.

    2. Use Western blotting or immunofluorescence with anti-HA/FLAG-tag antibodies to confirm protein absence.

    3. Validate chromatin associations via ChIP (e.g., Htz1 binding) .

Antibody Characterization in Yeast Studies

Recent efforts to standardize antibody validation (e.g., YCharOS initiatives) highlight the importance of rigorous controls, such as knockout cell lines, to confirm specificity. While YBL094C-specific antibodies are not explicitly cited, these protocols are critical for ensuring reliability in yeast proteome studies .

Key Research Findings

  • Transcriptional Regulation: YBL094C is weakly associated with chromatin-modifying proteins like Htz1, suggesting potential roles in transcriptional regulation .

  • Deletion Phenotypes: YBL094C deletion strains show no overt growth defects under standard conditions, implying redundancy or context-dependent functionality .

Challenges and Future Directions

  • Antibody Specificity: The lack of a commercially available YBL094C-specific antibody limits direct functional studies. Alternatives include epitope tagging (e.g., HA, FLAG) for indirect detection .

  • Functional Insights: Future work could employ CRISPR-based screens or synthetic genetic arrays to elucidate YBL094C’s role in yeast biology.

Relevance to Broader Antibody Research

  • Therapeutic Parallels: Antibody engineering techniques used in HIV research (e.g., CD4bs antibodies like N6) or cancer therapeutics (e.g., Relatlimab) demonstrate the importance of structural and functional characterization—principles applicable to yeast studies .

  • Validation Standards: Initiatives like YCharOS emphasize reproducible antibody performance, a framework that could accelerate YBL094C research if targeted reagents become available .

Product Specs

Buffer
**Preservative:** 0.03% Proclin 300
**Constituents:** 50% Glycerol, 0.01M PBS, pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
YBL094C; YBL0836; Putative uncharacterized protein YBL094C
Target Names
YBL094C
Uniprot No.

Target Background

Database Links

STRING: 4932.YBL094C

Subcellular Location
Membrane; Multi-pass membrane protein.

Q&A

What is YBL094C Antibody and what are its primary research applications?

YBL094C Antibody is a polyclonal antibody raised in rabbits against recombinant Saccharomyces cerevisiae (Baker's yeast) YBL094C protein. It specifically targets the YBL094C protein in Saccharomyces cerevisiae strain ATCC 204508/S288c. This antibody is purified using antigen affinity methods and is provided in liquid form .

The primary research applications for this antibody include Enzyme-Linked Immunosorbent Assay (ELISA) and Western Blotting (WB), making it a valuable tool for identifying and studying the YBL094C protein in yeast research contexts. It's important to note that this antibody is designated for research use only and should not be employed in diagnostic or therapeutic procedures .

When designing experiments with this antibody, researchers should consider that it has been specifically tested against Saccharomyces cerevisiae, and cross-reactivity with other species has not been established in the provided information.

What are the recommended storage and handling conditions for YBL094C Antibody?

Proper storage and handling of YBL094C Antibody are crucial for maintaining its functionality and ensuring reliable experimental results. Upon receipt, the antibody should be stored at either -20°C or -80°C. It's essential to avoid repeated freeze-thaw cycles as these can degrade antibody quality and reduce binding efficiency .

The antibody is supplied in a storage buffer containing 50% glycerol, 0.01M PBS at pH 7.4, and 0.03% Proclin 300 as a preservative. This formulation helps maintain antibody stability during storage . When handling the antibody:

  • Aliquot upon first thaw to minimize freeze-thaw cycles

  • Thaw aliquots at room temperature and briefly centrifuge before use

  • Keep on ice while working with the antibody

  • Return to -20°C or -80°C immediately after use

Following these handling practices will help preserve antibody integrity and ensure consistent experimental results across studies.

How should researchers determine the optimal concentration of YBL094C Antibody for different experimental applications?

Determining the optimal concentration of YBL094C Antibody requires careful titration for each specific experimental application. Research on antibody optimization suggests that most antibodies reach their saturation plateau at concentrations between 0.62 and 2.5 μg/mL, with concentrations above this range often leading to increased background without improving specific signal .

For titration experiments, researchers should:

  • Prepare a dilution series (e.g., fourfold dilutions) starting from the manufacturer's recommended concentration

  • Test each concentration in your experimental system (ELISA or Western blot)

  • Analyze both signal intensity and background levels

  • Select the concentration that provides optimal signal-to-noise ratio

Studies have shown that antibodies used at concentrations at or above 2.5 μg/mL often show minimal response to fourfold titration, both in terms of total signal and signal within positive populations. In contrast, antibodies used at concentrations at or below 0.62 μg/mL typically show a close to linear response to dilution .

When optimizing for Western blotting specifically, additional factors to consider include incubation time, temperature, and blocking conditions, all of which can affect the optimal antibody concentration.

What controls should be included when using YBL094C Antibody in experimental protocols?

Including appropriate controls when using YBL094C Antibody is essential for validating experimental results. Based on standard immunological research practices, the following controls should be considered:

  • Positive Control: Samples known to express the YBL094C protein from Saccharomyces cerevisiae (strain ATCC 204508/S288c)

  • Negative Control: Samples where YBL094C is known to be absent or samples from species other than S. cerevisiae to confirm specificity

  • Secondary Antibody Control: Samples processed with secondary antibody only (no primary YBL094C Antibody) to assess non-specific binding of the secondary antibody

  • Isotype Control: Another rabbit polyclonal IgG antibody that does not target YBL094C to identify potential non-specific binding

  • Blocking Peptide Control: When available, pre-incubation of the YBL094C Antibody with its immunizing peptide should block specific binding and confirm antibody specificity

For quantitative applications, researchers should also include a standard curve using recombinant YBL094C protein at known concentrations to enable accurate quantification .

When reporting results, inclusion of these controls demonstrates experimental rigor and increases confidence in the specificity of observed signals.

What strategies can improve signal-to-noise ratio when using YBL094C Antibody in Western blotting applications?

Optimizing the signal-to-noise ratio when using YBL094C Antibody in Western blotting requires systematic evaluation of multiple parameters. Research on antibody optimization reveals several effective strategies:

  • Antibody Titration: As mentioned earlier, antibodies often reach optimal performance at concentrations between 0.62-2.5 μg/mL. Higher concentrations frequently increase background without improving specific signal .

  • Blocking Optimization: Test different blocking agents (BSA, non-fat milk, commercial blockers) at various concentrations (3-5%) to determine which most effectively reduces non-specific binding while preserving specific signal.

  • Buffer Composition: The YBL094C Antibody is provided in a buffer containing 50% glycerol and 0.01M PBS at pH 7.4 . Consider diluting in fresh buffer with added detergents (0.05-0.1% Tween-20) to reduce background.

  • Incubation Conditions:

    • Primary antibody: Test both 1-2 hours at room temperature versus overnight at 4°C

    • Secondary antibody: Generally 1 hour at room temperature with gentle agitation

  • Washing Protocol: Implement stringent washing steps (4-5 washes of 5-10 minutes each) with PBS or TBS containing 0.05-0.1% Tween-20.

  • Exposure Optimization: For chemiluminescent detection, capture multiple exposure times to identify the optimal signal-to-noise ratio point.

Research has demonstrated that background signal can constitute a major fraction of total signal and is often skewed toward antibodies used at high concentrations . Therefore, finding the minimal effective concentration through careful titration is essential for achieving optimal results.

How can researchers validate the specificity of YBL094C Antibody for their particular experimental system?

Validating the specificity of YBL094C Antibody is critical for ensuring research rigor and reproducibility. Comprehensive validation should include multiple approaches:

  • Genetic Validation:

    • Test the antibody in YBL094C knockout/deletion strains of S. cerevisiae

    • Compare signal between wild-type and mutant strains to confirm specificity

    • If using tagged versions of YBL094C, compare detection with anti-tag antibodies

  • Immunoprecipitation Followed by Mass Spectrometry:

    • Perform IP with YBL094C Antibody

    • Analyze precipitated proteins by mass spectrometry

    • Confirm that YBL094C is the predominant protein identified

  • Peptide Competition Assay:

    • Pre-incubate the antibody with excess immunizing peptide

    • Compare results with and without peptide competition

    • Specific signals should be significantly reduced in the presence of competing peptide

  • Orthogonal Detection Methods:

    • Compare results with alternative antibodies targeting different epitopes of YBL094C

    • Correlate protein detection with mRNA expression data

    • Use fluorescently tagged YBL094C to confirm co-localization with antibody staining

  • Cross-Reactivity Assessment:

    • Test the antibody against closely related yeast proteins

    • Examine potential cross-reactivity in other yeast species

Proper validation ensures that experimental findings truly reflect YBL094C biology rather than artifacts from non-specific antibody interactions .

What are the methodological considerations for using YBL094C Antibody in quantitative applications?

Using YBL094C Antibody for quantitative applications requires strict methodological controls to ensure accurate and reproducible measurements:

  • Standard Curve Generation:

    • Use purified recombinant YBL094C protein at known concentrations

    • Prepare standards in the same buffer as experimental samples

    • Include standards on each experimental plate/blot

  • Linear Range Determination:

    • Establish the linear detection range for the antibody

    • Ensure experimental measurements fall within this range

    • Dilute samples if necessary to remain in the linear range

  • Titration Optimization:

    • Research shows that antibodies often reach their saturation plateau between 0.62-2.5 μg/mL

    • Perform careful titration to identify the concentration that provides consistent signal while minimizing background

  • Normalization Strategy:

    • Use appropriate loading controls for Western blots

    • For ELISA, normalize to total protein concentration

    • Consider dual detection approaches for improved accuracy

  • Technical Replication:

    • Run samples in triplicate to assess technical variability

    • Calculate coefficient of variation (CV) to ensure measurements are within acceptable limits

  • Assay Validation Parameters:

    • Determine limit of detection (LOD) and limit of quantification (LOQ)

    • Assess intra- and inter-assay precision

    • Evaluate recovery and dilutional linearity

Studies have shown that background signal in empty droplets can constitute a major fraction of the total signal and is often skewed toward antibodies used at high concentrations . This highlights the importance of background correction in quantitative applications to ensure accurate measurements.

How does the polyclonal nature of YBL094C Antibody affect experimental design and interpretation of results?

The polyclonal nature of YBL094C Antibody has significant implications for experimental design and data interpretation that researchers must consider:

  • Epitope Recognition:

    • Polyclonal antibodies recognize multiple epitopes on the target protein

    • This provides robust detection even if some epitopes are masked or modified

    • May detect the target under varying conditions (denatured, native, post-translationally modified)

  • Lot-to-Lot Variability:

    • Different production lots may have varying epitope specificity profiles

    • Critical experiments should use the same lot when possible

    • Lot validation is recommended before using a new batch for continuing studies

  • Cross-Reactivity Considerations:

    • Polyclonal antibodies have higher potential for cross-reactivity than monoclonals

    • Thorough validation is essential, particularly in complex samples

    • Absorption controls may be needed to improve specificity

  • Signal Interpretation:

    • Higher sensitivity but potentially lower specificity compared to monoclonals

    • Signal strength may not perfectly correlate with protein abundance due to epitope availability variations

    • Multiple antibody molecules may bind a single target, potentially amplifying signal

  • Application Suitability:

    • Well-suited for detection applications like Western blot and ELISA

    • May require additional controls for applications requiring absolute specificity

Understanding these characteristics helps researchers design appropriate experiments and correctly interpret results when using YBL094C polyclonal antibody. For particularly sensitive or high-stakes experiments, researchers might consider using multiple detection methods to confirm findings .

What approaches can be used to troubleshoot unexpected results when using YBL094C Antibody?

When facing unexpected results with YBL094C Antibody, a systematic troubleshooting approach should be implemented:

  • No Signal or Weak Signal:

    • Verify antibody integrity (check storage conditions, expiration)

    • Test higher antibody concentrations (within 0.62-2.5 μg/mL optimal range)

    • Extend incubation time or adjust temperature

    • Ensure target is present in sample (use positive control)

    • Check detection system functionality with a known working antibody

    • Consider epitope masking or protein denaturation issues

  • High Background:

    • Reduce antibody concentration (concentrations above 2.5 μg/mL often increase background)

    • Optimize blocking (try different blockers or increase concentration)

    • Increase washing stringency (more washes, longer duration, higher detergent)

    • Check for cross-reactivity with sample components

    • Ensure secondary antibody specificity

  • Multiple or Unexpected Bands/Signals:

    • Verify sample purity and preparation

    • Test antibody specificity with peptide competition

    • Consider post-translational modifications, degradation products, or splice variants

    • Compare with literature reports on expected patterns

    • Sequence the detected protein bands to confirm identity

  • Inconsistent Results Between Experiments:

    • Standardize protocols meticulously

    • Use the same antibody lot when possible

    • Implement positive and negative controls consistently

    • Control for environmental variables (temperature, incubation times)

    • Consider the 14-16 week lead time for new antibody production when planning experiments

  • Quantification Issues:

    • Ensure measurements fall within the linear range

    • Use appropriate normalization controls

    • Consider that antibodies at high concentrations may exhibit non-linear responses to dilution

Creating a detailed troubleshooting record helps track variables and solutions, facilitating more efficient problem-solving in future experiments.

How can YBL094C Antibody be incorporated into multimodal single-cell analysis protocols?

Incorporating YBL094C Antibody into multimodal single-cell analysis requires careful consideration of antibody concentration, staining volume, and cell count to optimize signal while minimizing background:

  • Antibody Concentration Optimization:

    • Research indicates that most antibodies reach optimal performance at concentrations between 0.62-2.5 μg/mL

    • Concentrations above this range typically increase background without improving specific signal

    • Perform fourfold dilution series to identify optimal concentration for YBL094C Antibody

  • Staining Volume Considerations:

    • Studies show that reducing staining volume from 50 μL to 25 μL has minimal effect on signal for most antibodies

    • Antibodies used at low concentrations (0.0125-0.025 μg/mL) targeting highly abundant epitopes are most affected by reduced volume

    • For YBL094C Antibody, maintaining adequate staining volume is particularly important if target expression is high

  • Cell Count Adjustment:

    • Reducing cell count during staining can counteract potential issues from reduced staining volume

    • Aim for optimal cell density to ensure adequate antibody availability per cell

    • Consider the balance between cell recovery needs and antibody binding efficiency

  • Panel Design Integration:

    • When incorporating YBL094C Antibody into larger antibody panels, balance signal across all antibodies

    • An optimal panel should use similar UMI counts per positive cell for each antibody

    • Adjust individual antibody concentrations to achieve approximately equal positive signal above background

  • Background Reduction Strategies:

    • Empty droplets can contain a significant fraction of total signal, particularly from antibodies used at high concentrations

    • Properly titrated panels show lower percentage of UMIs assigned to background

    • For YBL094C Antibody, careful titration can potentially reduce background UMIs by 4-5 fold while maintaining positive signal

This methodological approach ensures optimal signal-to-noise ratio when incorporating YBL094C Antibody into complex single-cell analysis protocols.

What methodologies can be employed to modify YBL094C Antibody for specialized research applications?

While YBL094C Antibody is provided as a non-conjugated polyclonal antibody , researchers may need to modify it for specialized applications. Several methodological approaches can be employed:

  • Direct Labeling:

    • Fluorescent conjugation (FITC, Cy3, Alexa Fluors) for flow cytometry or microscopy

    • Enzymatic conjugation (HRP, AP) for enhanced detection sensitivity

    • Biotin labeling for streptavidin-based amplification systems

    • Use commercial antibody labeling kits with optimized protocols for each conjugation type

  • Fragmentation for Improved Tissue Penetration:

    • Papain digestion to generate Fab fragments

    • Pepsin digestion to produce F(ab')₂ fragments

    • Size exclusion chromatography for fragment purification

  • Cross-linking for Improved Stability:

    • Glutaraldehyde treatment to stabilize antibody structure

    • BS3 or DSS cross-linking of antibody-antigen complexes

    • Monitor activity post-cross-linking to ensure epitope recognition is maintained

  • Oligo-Conjugation for Single-Cell Technologies:

    • DNA oligonucleotide conjugation for CITE-seq applications

    • Ensure optimal antibody:oligo ratio to maintain binding while providing sufficient signal

    • Titrate oligo-conjugated antibodies as their behavior differs from unconjugated forms

  • Bispecific Adaptation:

    • Combine YBL094C binding capacity with other specificities

    • Methods include chemical cross-linking to another antibody

    • Consider Fc engineering to modify effector functions if needed

When modifying YBL094C Antibody, it's critical to validate that the modification process has not compromised binding specificity or affinity. Always include proper controls, including unmodified antibody, to assess any changes in performance characteristics post-modification .

What are the considerations for using YBL094C Antibody in conjunction with other antibodies in multiplex assays?

Using YBL094C Antibody in multiplex assays requires careful planning to ensure compatibility with other antibodies and optimal performance:

  • Species Cross-Reactivity Prevention:

    • YBL094C Antibody is raised in rabbit , so avoid rabbit-derived secondary antibodies when multiplexing

    • Use isotype-specific or species-specific secondary antibodies to prevent cross-detection

    • Consider the use of directly labeled primary antibodies to avoid secondary antibody complications

  • Panel Design and Balance:

    • Research shows that optimal antibody panels should have similar signal levels across all antibodies

    • Adjust individual antibody concentrations to achieve approximately equal positive signal

    • An imbalanced panel will result in some markers dominating the sequencing reads while others are underrepresented

  • Concentration Optimization:

    • Each antibody in a multiplex panel will have its own optimal concentration

    • Most antibodies reach saturation plateau between 0.62-2.5 μg/mL

    • Higher concentrations typically only increase background without improving specific signal

    • Test YBL094C Antibody at multiple concentrations within this range when used in multiplex

  • Epitope Competition Assessment:

    • Test for potential epitope blocking or steric hindrance between antibodies

    • Compare signals when antibodies are used individually versus in combination

    • Sequence the addition of antibodies if blocking occurs

  • Signal Balance Optimization:

    • An ideal panel would use similar number of UMIs per positive cell for each antibody

    • Titrate to achieve approximately the same positive signal above background for all antibodies

    • This approach ensures efficient use of sequencing resources and balanced detection

  • Background Management:

    • Monitor and minimize background signal contribution from each antibody

    • Properly titrated panels show lower percentage of UMIs assigned to background

    • Be aware that background signal in empty droplets can constitute a major fraction of the total signal

These methodological considerations ensure optimal performance of YBL094C Antibody within multiplex experimental systems while maximizing data quality and resource efficiency.

What emerging technologies might enhance the utility of YBL094C Antibody in yeast research?

Several emerging technologies hold promise for expanding the research applications of YBL094C Antibody in Saccharomyces cerevisiae studies:

  • Advanced Single-Cell Technologies:

    • Adaptation of YBL094C Antibody for CITE-seq and other single-cell multi-omic approaches

    • Integration with spatial transcriptomics to correlate protein localization with gene expression

    • Development of optimized oligo-conjugation methods specifically for yeast cell analysis

  • Super-Resolution Microscopy Applications:

    • Conjugation with photo-switchable fluorophores for STORM/PALM microscopy

    • Development of expansion microscopy protocols compatible with yeast cell walls

    • Correlation of YBL094C localization with ultrastructural features

  • In Situ Proximity Labeling:

    • Conjugation of YBL094C Antibody with enzymes like BioID or APEX2

    • Identification of protein-protein interactions in native cellular contexts

    • Comparison with other protein interaction mapping approaches in yeast

  • Automated High-Content Screening:

    • Integration with robotics for large-scale phenotypic screening

    • Machine learning algorithms for automated image analysis of YBL094C distribution

    • Correlation of localization patterns with genetic or environmental perturbations

  • Nanobody or Single-Domain Antibody Development:

    • Development of smaller binding reagents based on YBL094C Antibody epitope mapping

    • Enhanced penetration of yeast cell wall for live-cell imaging

    • Potential for intrabody applications to study protein function in vivo

  • Engineering Approaches:

    • Application of bispecific antibody technologies to create dual-targeting reagents

    • Integration of YBL094C targeting with effector functions for targeted protein modulation

    • Fc engineering techniques to improve specificity or add novel functionalities

These emerging approaches could significantly expand the utility of YBL094C Antibody beyond its current applications in ELISA and Western blotting , enabling more sophisticated studies of YBL094C function in yeast biology.

How might computational approaches improve experimental design with YBL094C Antibody?

Computational approaches offer powerful tools to enhance experimental design and data interpretation when working with YBL094C Antibody:

  • Epitope Prediction and Analysis:

    • In silico prediction of YBL094C antigenic determinants

    • Structural modeling to identify surface-exposed epitopes

    • Comparison with related proteins to assess potential cross-reactivity

  • Optimal Protocol Design:

    • Machine learning algorithms to predict optimal antibody concentrations based on target abundance

    • Computational modeling of staining kinetics to optimize incubation conditions

    • Statistical design of experiments (DoE) to efficiently optimize multiple parameters simultaneously

  • Automated Image Analysis:

    • Deep learning algorithms for automated detection and quantification of YBL094C signals

    • Computer vision approaches for co-localization analysis

    • Tracking algorithms for dynamic studies of YBL094C movement

  • Integrated Multi-omics Analysis:

    • Correlation of YBL094C protein levels with transcriptomic and metabolomic data

    • Network analysis to place YBL094C in functional pathways

    • Identification of potential regulatory relationships

  • Developability Assessment Tools:

    • In silico prediction of antibody biophysical properties

    • Modeling of potential post-translational modifications affecting binding

    • Assessment of stability under various experimental conditions

  • Signal Optimization Algorithms:

    • Computational methods to maximize signal-to-noise ratio

    • Deconvolution algorithms for improved signal separation in multiplex experiments

    • Background estimation and correction methods specific to antibody-based detection

By integrating these computational approaches into research workflows, scientists can design more efficient experiments, extract more meaningful data, and gain deeper insights into YBL094C biology through optimized use of the antibody.

What are the key considerations for researchers designing experiments with YBL094C Antibody?

When designing experiments with YBL094C Antibody, researchers should consider several critical factors to ensure robust and reproducible results:

  • Antibody Specifications:

    • YBL094C Antibody is a polyclonal antibody raised in rabbit against recombinant S. cerevisiae YBL094C protein

    • It is specifically validated for ELISA and Western blot applications

    • The antibody is provided in liquid form with a 50% glycerol buffer

  • Concentration Optimization:

    • Most antibodies reach optimal performance at concentrations between 0.62-2.5 μg/mL

    • Concentrations above this range typically increase background without improving specific signal

    • Titration experiments are essential to determine the optimal concentration for specific applications

  • Experimental Controls:

    • Include positive and negative controls in every experiment

    • Implement isotype controls to assess non-specific binding

    • Consider peptide competition assays to confirm specificity

  • Storage and Handling:

    • Store at -20°C or -80°C

    • Avoid repeated freeze-thaw cycles

    • Consider aliquoting the antibody upon first thaw

  • Signal Optimization:

    • Balance antibody concentration with incubation conditions

    • Optimize blocking and washing protocols to maximize signal-to-noise ratio

    • Consider the impact of staining volume and cell count in flow cytometry or single-cell applications

  • Multiplexing Considerations:

    • When used in antibody panels, balance signal across all antibodies

    • Be aware of potential cross-reactivity or epitope competition

    • Optimize each antibody individually before combining into panels

By systematically addressing these considerations, researchers can maximize the utility of YBL094C Antibody in their experimental systems and generate high-quality, reproducible data for studying this yeast protein.

How can researchers evaluate and compare results obtained with YBL094C Antibody across different studies?

Evaluating and comparing results obtained with YBL094C Antibody across different studies requires attention to methodological details and standardization:

  • Protocol Documentation:

    • Record detailed protocols including antibody concentration, incubation conditions, and detection methods

    • Note the antibody lot number, as polyclonal antibodies may show lot-to-lot variation

    • Document the exact strain of S. cerevisiae used, as the antibody is specifically validated for strain ATCC 204508/S288c

  • Standardization Approaches:

    • Use common reference standards across studies when possible

    • Implement normalized reporting of results (e.g., relative to housekeeping proteins)

    • Consider developing laboratory reference materials for inter-lab comparisons

  • Quantification Methods:

    • Clearly describe image analysis or signal quantification methodologies

    • Use consistent gating strategies for flow cytometry experiments

    • Report both raw and normalized data where appropriate

  • Statistical Analysis:

    • Employ appropriate statistical tests based on data distribution

    • Report variability measures (standard deviation, confidence intervals)

    • Consider statistical power in experimental design

  • Reproducibility Assessment:

    • Implement technical and biological replicates

    • Validate key findings with orthogonal methods

    • Consider independent validation in different laboratories for critical results

  • Data Sharing:

    • Provide access to raw data when possible

    • Share detailed protocols through repositories or protocol sharing platforms

    • Report negative or contradictory results to build a complete understanding

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.