YFR054C Antibody

What is YFR054C and what is its functional significance in Saccharomyces cerevisiae?

YFR054C is a gene in Saccharomyces cerevisiae (baker's yeast) that encodes a protein identified in the Uniprot database with accession number P43622. This gene is classified as a putative open reading frame (ORF) in the S. cerevisiae genome . In research contexts, this locus has been used for the integration of other expression cassettes, such as MDM34-mGFP, suggesting it may be a non-essential gene or a location with minimal impact when disrupted . The gene is primarily studied in the laboratory strain ATCC 204508/S288c, which serves as a reference strain for many yeast studies .

The functional characterization of YFR054C remains an active area of investigation, with researchers using various molecular approaches including CRISPR-Cas9 gene editing to understand its role. The availability of specific gRNA (GCTCAAAGAAACAATTAGAG) targeting this gene facilitates precise genetic manipulation in functional studies .

What are the standard applications of YFR054C antibody in yeast research?

YFR054C antibodies are primarily used in fundamental yeast research applications including:

• Western blot analysis: For detecting and quantifying YFR054C protein expression levels under different experimental conditions. This typically involves protein extraction followed by SDS-PAGE separation and immunoblotting .

• Protein localization studies: Similar to studies with other yeast proteins, immunofluorescence microscopy using YFR054C antibodies can help determine the subcellular localization of the protein.

• Verification of genetic manipulations: When YFR054C is modified, deleted, or used as an integration site for other genes, the antibody can confirm successful manipulation at the protein level .

• Studies of protein-protein interactions: In conjunction with techniques like co-immunoprecipitation to identify interaction partners.

The antibody is often used alongside controls such as anti-Pgk1 (phosphoglycerate kinase) antibody, which serves as a loading control for Western blots in yeast research .

How should I design proper controls when using YFR054C antibody in my experiments?

Designing appropriate controls is crucial for interpreting results obtained with YFR054C antibody:

• Positive control: Include a sample known to express YFR054C protein. This could be wild-type S. cerevisiae (strain ATCC 204508/S288c) .

• Negative control: Use a YFR054C deletion strain or a sample where the gene has been replaced with another expression cassette via homologous recombination .

• Loading control: For Western blot experiments, include an antibody against a constitutively expressed protein like Pgk1, which is commonly used as a loading control in yeast studies .

• Secondary antibody control: Include a sample that is only treated with the secondary antibody to assess non-specific binding.

• Cross-reactivity assessment: If working with multiple yeast strains or closely related species, validate the specificity of the antibody across these samples.

When conducting Western blot analysis, it's essential to systematically assess the amount of expressed protein across different experimental conditions, as demonstrated in studies that verify comparable expression levels across different strains and conditions .

What protein extraction methods are recommended for YFR054C detection in yeast cells?

Based on established protocols for yeast protein extraction that would be applicable to YFR054C detection:

Recommended protocol:

• Resuspend cell pellets in 400 μl of cold NaOH (0.15 M)

• Vortex briefly and leave on ice for 5 minutes

• Centrifuge at 4,700 g, 4°C for 3 minutes

• Remove supernatant and resuspend pellets in 50 μl of 2× SDS loading buffer for each 1 × 10^7 cells

• Vortex briefly and heat at 65°C for 10 minutes

• Centrifuge at 21,000 g for 5 minutes

This method results in denatured protein samples suitable for SDS-PAGE and Western blot analysis. The alkaline treatment helps to break down the yeast cell wall while preserving protein integrity. For optimal results, protein samples should be separated on precast 4-20% gradient gels and transferred to nitrocellulose membranes for immunoblotting .

When detecting YFR054C specifically, researchers typically use antibody dilutions in the range of 1:5,000, similar to other yeast protein antibodies used in Western blot applications .

How can I optimize Western blot conditions for YFR054C detection?

Optimizing Western blot conditions for YFR054C detection involves several key considerations:

• Protein separation: Use precast 4-20% Mini-PROTEAN TGX gels or similar gradient gels that provide good resolution for a wide range of protein sizes .

• Transfer conditions: Transfer to nitrocellulose membranes with standard parameters (typically 100V for 1 hour or 30V overnight at 4°C) to ensure efficient protein transfer.

• Blocking: Use 5% non-fat dry milk or BSA in TBST (Tris-buffered saline with 0.1% Tween-20) for 1 hour at room temperature to minimize background.

• Antibody dilution: Based on similar yeast antibody applications, use YFR054C antibody at approximately 1:5,000 dilution in blocking buffer .

• Incubation conditions: Incubate with primary antibody overnight at 4°C with gentle agitation for optimal binding.

• Detection system: Use an appropriate HRP-conjugated secondary antibody and a sensitive chemiluminescent detection system.

• Controls: Always include positive and negative controls as described earlier, as well as a molecular weight marker to confirm the expected size of your target protein.

• Loading amount: Load 10-20 μg of total protein per lane for standard detection. Adjust based on the abundance of YFR054C in your specific samples.

What growth conditions should be used to study YFR054C expression in yeast?

When studying YFR054C expression, consider these established yeast growth conditions:

Standard growth conditions:

• Use YPD medium (1% yeast extract, 2% peptone, 2% glucose) for routine culture

• For experimental cultures, synthetic complete (SC) medium (0.67% yeast nitrogen base with all amino acids) containing either 2% glucose (SD) or 2% galactose (SG) is recommended

• Grow cultures to OD~1.0 before experimental treatments or protein extraction

Specialized conditions to study regulation:

• Stationary phase: Grow cells in YPD for 3 days to observe changes in expression during the stationary phase

• Calorie restriction: Use YPD with reduced glucose (0.5%) to study expression under calorie-restricted conditions

• Carbon source manipulation: For induction experiments, grow cells in appropriate media for 60 minutes. For carbon source removal studies, spin cells, wash briefly, and resuspend in SC medium without carbon source

These conditions allow for the systematic study of YFR054C protein expression under different physiological states and stress conditions, providing insights into its regulation and function.

How can I use CRISPR-Cas9 to study YFR054C function?

CRISPR-Cas9 gene editing offers powerful approaches to study YFR054C function. Based on available resources:

• Gene targeting resources: The plasmid pML107-YFR054C (Addgene #232900) contains Cas9 and a specific gRNA (GCTCAAAGAAACAATTAGAG) that targets the YFR054C gene . This plasmid is available to academics and nonprofits.

• Experimental strategy:

  • Transform the pML107-YFR054C plasmid into S. cerevisiae

  • Co-transform with a repair template containing your desired modification (deletion, point mutation, or tag insertion)

  • Select transformants with LEU2 marker selection (the plasmid contains the LEU2 selectable marker)

  • Confirm edits by sequencing and validate at the protein level using YFR054C antibody

• Validation approaches:

  • Confirm gene editing at the DNA level by PCR amplification and sequencing

  • Validate changes at the protein level using Western blot with YFR054C antibody

  • Assess phenotypic consequences through growth assays, microscopy, or other functional tests

The pML107 backbone is a high-copy yeast expression vector designed specifically for CRISPR-Cas9 experiments in S. cerevisiae, making it an ideal tool for precise genetic manipulation of YFR054C .

How can I use YFR054C as a genomic locus for protein expression studies?

YFR054C has been utilized as an integration site for expressing other proteins, suggesting it can serve as a useful genomic locus for heterologous protein expression:

• Integration strategy: The YFR054C locus can be targeted for gene replacement via homologous DNA recombination. For example, researchers have inserted MDM34-mGFP into this locus using PCR amplicons with homologous flanking regions .

• Primer design for integration:

  • Design primers with 40-50 bp overhangs homologous to the genomic regions flanking YFR054C

  • Include your gene of interest in the amplicon

  • Recommended PCR conditions: 98°C, 2 min; followed by 10 cycles of (98°C, 30s; 62°C, 30s; 72°C, 2min 40s); then 25 cycles of (98°C, 15s; 62°C, 30s; 72°C, 2min 40s with 10s extension/cycle); final extension at 72°C, 10 min

• Selection strategy:

  • Include an appropriate selection marker (e.g., natNT2, kanMX4, or hphNT1) in your integration cassette

  • These confer resistance to nourseothricin, geneticin, or hygromycin B, respectively

• Verification methods:

  • Confirm correct integration by PCR amplification across integration junctions

  • Verify protein expression using antibodies against your protein of interest

  • Use YFR054C antibody as a control to confirm complete replacement of the native gene

This approach is particularly useful for studying protein localization, interactions, or function in the native yeast cellular environment.

What are common issues when using YFR054C antibody and how can I resolve them?

When troubleshooting, systematically assess each step of your protocol. For Western blot analysis, it's essential to verify that your YFR054C protein and control proteins (such as Pgk1) are being expressed at comparable and detectable levels across different experimental conditions .

How can I validate the specificity of YFR054C antibody in my experimental system?

Validating antibody specificity is crucial for reliable results. Consider these approaches:

• Genetic validation:

  • Compare results from wild-type and YFR054C deletion strains

  • The antibody should yield a specific band in wild-type samples that is absent in deletion strains

  • Create strains with tagged versions of YFR054C (e.g., with GFP or RUBY2) and correlate antibody detection with tag detection

• Biochemical validation:

  • Perform peptide competition assays where the antibody is pre-incubated with the immunizing peptide

  • This should abolish specific signals if the antibody is truly specific

  • Compare the migration pattern with the expected molecular weight of YFR054C

• Cross-reactivity assessment:

  • Test the antibody against samples from related yeast species

  • Analyze reactivity in different yeast strains beyond the standard S288c laboratory strain

  • Validate in different genetic backgrounds where YFR054C might have slight variations

• Methodological controls:

  • Include secondary antibody-only controls to assess non-specific binding

  • Use different blocking agents to minimize background

  • Compare results using different protein extraction methods

Proper validation ensures that your experimental observations genuinely reflect YFR054C biology rather than artifacts of antibody cross-reactivity.

How does YFR054C expression change under different stress conditions?

Understanding how YFR054C responds to various cellular stresses can provide insights into its function. Based on established protocols for studying stress responses in yeast:

Recommended stress conditions and analysis approach:

• Oxidative stress: Treat cells with 1.5 mM H₂O₂ and monitor YFR054C expression changes over time

• Mitochondrial stress: Apply 50 μM CCCP (carbonyl cyanide m-chlorophenyl hydrazone) to disrupt mitochondrial membrane potential

• ER stress: Treat cells with 8 mM DTT to induce the unfolded protein response and assess changes in YFR054C levels. Monitor UPR activation using anti-Kar2 antibody (dilution 1:2,000) as a control

• Metabolic stress:

  • Carbon source removal: Wash and resuspend cells in media without carbon source

  • 2-Deoxyglucose treatment: Use SD with 0.2% glucose plus 33.33 mM 2-DOG

  • Antimycin A treatment: Add to galactose-depleted cells at 10 μM concentration

• Quantification approach:

  • Perform time-course Western blot analysis using YFR054C antibody

  • Quantify band intensities using image analysis software

  • Normalize to loading controls (e.g., Pgk1)

  • Present data as fold-change relative to untreated controls

Systematic analysis across these conditions can reveal potential roles in stress response pathways and provide clues to functional significance.

What are the considerations for using YFR054C antibody in co-immunoprecipitation experiments?

Co-immunoprecipitation (Co-IP) with YFR054C antibody can help identify interaction partners. Consider these methodological aspects:

• Sample preparation:

  • Use mild lysis conditions to preserve protein-protein interactions (e.g., 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NP-40, 1 mM EDTA with protease inhibitors)

  • Clear lysates by centrifugation (21,000 g, 10 minutes, 4°C)

  • Pre-clear with protein A/G beads to reduce non-specific binding

• Immunoprecipitation strategy:

  • Conjugate YFR054C antibody to protein A/G beads or use pre-conjugated magnetic beads

  • Incubate pre-cleared lysate with antibody-conjugated beads overnight at 4°C with gentle rotation

  • Wash extensively (at least 5 times) with lysis buffer containing reduced detergent

  • Elute bound proteins with 2× SDS sample buffer or gentle elution buffer for mass spectrometry analysis

• Controls to include:

  • IgG control: Use the same amount of non-specific IgG from the same species as the YFR054C antibody

  • Input sample: Save a portion (5%) of the pre-cleared lysate

  • YFR054C deletion strain: Perform parallel Co-IP to identify non-specific interactions

• Verification approaches:

  • Confirm successful IP of YFR054C by Western blot

  • Identify co-precipitated proteins by mass spectrometry or targeted Western blot for suspected interaction partners

  • Validate key interactions with reciprocal Co-IP experiments

This approach allows for the identification of protein complexes involving YFR054C, providing insights into its functional network within the cell.

How can I integrate YFR054C research with broader yeast systems biology approaches?

Advancing YFR054C research within systems biology frameworks offers several promising directions:

• Genome-wide interaction studies:

  • Perform synthetic genetic array (SGA) analysis with YFR054C deletion strains

  • Identify genetic interactions that reveal functional relationships

  • Use CRISPR-based screens to identify genes that modify YFR054C-related phenotypes

• Multi-omics integration:

  • Combine proteomics data (using YFR054C antibody) with transcriptomics and metabolomics

  • Map YFR054C into existing protein interaction networks

  • Correlate expression changes with metabolic shifts under various conditions

• Comparative genomics approach:

  • Study YFR054C homologs across yeast species

  • Analyze evolutionary conservation to infer functional importance

  • Compare expression patterns and regulation across related organisms

• Protein localization dynamics:

  • Create fluorescently tagged versions of YFR054C (e.g., with mGFP or RUBY2)

  • Perform live-cell imaging to track localization changes under different conditions

  • Correlate localization with function using quantitative microscopy approaches

• Computational modeling:

  • Integrate experimental data into existing yeast systems biology models

  • Predict functional roles based on network position and dynamics

  • Use machine learning approaches to identify patterns in multi-omics data

These approaches can help position YFR054C research within the broader context of yeast biology and potentially reveal unexpected functions and relationships.

What emerging technologies might enhance YFR054C antibody-based research?

Several cutting-edge technologies can significantly advance YFR054C antibody-based research:

• Proximity labeling approaches:

  • Fuse YFR054C to BioID or TurboID for in vivo proximity labeling

  • Identify proteins in close proximity to YFR054C in living cells

  • Map the spatial environment of YFR054C in different cellular compartments

• Single-cell proteomics:

  • Apply new mass spectrometry techniques for single-cell protein analysis

  • Study cell-to-cell variation in YFR054C expression and its correlates

  • Identify rare cellular states with distinct YFR054C regulation

• Cryo-electron microscopy:

  • Use YFR054C antibodies to identify and purify protein complexes

  • Determine high-resolution structures of these complexes

  • Gain structural insights into YFR054C function

• Super-resolution microscopy:

  • Apply techniques such as STORM or PALM with YFR054C antibodies

  • Achieve nanometer-scale resolution of protein localization

  • Correlate fine-scale localization with function

• CRISPR-based technologies:

  • Utilize CRISPR-based techniques beyond gene editing

  • Apply CRISPRi/CRISPRa for tunable repression/activation of YFR054C

  • Use base editors for precise point mutations to study structure-function relationships

These emerging technologies offer powerful new ways to explore YFR054C biology at unprecedented resolution and depth, potentially revealing novel functions and regulatory mechanisms.