SPAC186.05c Antibody

Shipped with Ice Packs
In Stock

Description

Research Applications

The antibody is primarily used to study gene expression and protein localization in fission yeast. Key findings from studies include:

  • Role in Heterochromatin Regulation: SPAC186.05c is located in subtelomeric regions, which are associated with heterochromatin formation. Cohesin proteins (e.g., Mis4) influence the expression of subtelomeric genes like SPAC186.05c, as shown by transcriptome analyses in mis4-367 mutants .

  • Primer Design for Analysis: Primer sequences (Forward: AAATTTTCCCGGGCTTTCAT, Reverse: TCCGACAATCACCGCTACC) have been used in real-time PCR to quantify SPAC186.05c expression in chromatin immunoprecipitation (ChIP) assays .

Mechanism and Antibody Function

  • Structure: Polyclonal antibodies like SPAC186.05c contain multiple paratopes targeting different epitopes of the antigen, enhancing detection sensitivity .

  • Fc Region: The antibody’s Fc region facilitates interactions with protein G agarose beads or ChIP-Adembeads for immunoprecipitation .

  • Applications in Protein Analysis:

    • Western Blot: Validates protein size and expression levels under experimental conditions (e.g., temperature shifts) .

    • ELISA: Quantifies antigen presence in lysates or purified samples .

Transcriptional Regulation

In mis4-367 mutants, SPAC186.05c exhibited altered expression during temperature shifts, suggesting cohesin’s role in stabilizing subtelomeric heterochromatin domains .

Table 1: Gene Expression Changes in mis4-367 Mutants

GeneFold ChangeFunction (Predicted)Location
SPAC186.012.66GlycoproteinSubtelomeric
SPAC186.02c2.932-Hydroxyacid dehydrogenaseSubtelomeric
SPAC186.05cN/ANot explicitly quantifiedSubtelomeric

Note: SPAC186.05c’s primers were used in ChIP assays, but its direct expression fold change was not reported .

Quality Control and Validation

  • Specificity: Validated via antigen-affinity purification and reactivity tests in Schizosaccharomyces pombe.

  • Cross-Reactivity: No reported cross-reactivity with other yeast species or human proteins .

Limitations and Usage Notes

  • Research Use Only: Not validated for diagnostic or therapeutic purposes .

  • Handling: Requires precise storage conditions to maintain stability.

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M Phosphate Buffered Saline (PBS), pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
SPAC186.05c; GDT1-like protein C186.05c
Target Names
SPAC186.05c
Uniprot No.

Target Background

Database Links
Protein Families
GDT1 family
Subcellular Location
Endoplasmic reticulum membrane; Multi-pass membrane protein.

Q&A

What validation standards should be applied to SPAC186.05c antibodies?

Validation of SPAC186.05c antibodies requires a multi-tiered approach similar to that used for other S. pombe proteins:

  • Western blot validation:

    • Test against recombinant SPAC186.05c protein (positive control)

    • Compare signal between wild-type and SPAC186.05c deletion strains

    • Assess specificity via peptide competition assays

  • Specificity metrics:

    • Signal ratio between wild-type and knockout samples should exceed 10:1

    • Peptide competition should eliminate >90% of specific signal

    • Cross-reactivity with related proteins should be <10%

According to antibody development studies, approximately 53% of monoclonal antibodies show positive results against recombinant proteins in Western blots, while only 34% detect endogenous proteins in cell lines . These benchmarks should guide expectations when validating new SPAC186.05c antibodies.

What are the key applications for SPAC186.05c antibodies in S. pombe research?

SPAC186.05c antibodies can be applied across multiple experimental techniques:

ApplicationMethodologySuccess Rate*Key Considerations
Western BlottingProtein detection via SDS-PAGE and immunoblotting34%Optimize blocking and antibody dilution
ImmunoprecipitationProtein complex isolation13%Buffer composition critical for membrane proteins
ImmunofluorescenceSubcellular localizationVariableFixation method affects epitope accessibility
ChIP-seqChromatin interaction analysisNot determinedCrosslinking optimization critical
Protein ArraysInteraction screening14%Higher false positive/negative rates

*Success rates based on similar monoclonal antibody development projects

How should researchers optimize Western blotting protocols for SPAC186.05c detection?

For optimal Western blot detection of SPAC186.05c, researchers should implement this methodological approach:

  • Sample preparation:

    • Extract total protein from exponentially growing S. pombe cultures using a membrane-protein-optimized lysis buffer (50mM Tris-HCl pH 7.5, 150mM NaCl, 1% NP-40 or 1% Triton X-100, protease inhibitors)

    • Sonicate samples (3-5 pulses of 10 seconds) to ensure membrane protein solubilization

    • Heat samples at 70°C (not 95°C) for 10 minutes to prevent aggregation of transmembrane domains

  • Electrophoresis conditions:

    • Use 10-12% SDS-PAGE gels for optimal resolution

    • Load 20-50 μg total protein per lane

    • Include recombinant SPAC186.05c as positive control

  • Transfer and detection:

    • Transfer to PVDF membrane (preferred over nitrocellulose for hydrophobic proteins)

    • Block with 5% non-fat dry milk or BSA in TBST

    • Primary antibody dilution starting at 1:1000, incubating overnight at 4°C

    • Wash stringently (5-6 times, 10 minutes each)

This approach addresses the specific challenges of membrane protein detection and has shown higher success rates in antibody validation studies for similar proteins .

What considerations are essential for immunoprecipitation experiments with SPAC186.05c antibodies?

Successful immunoprecipitation of SPAC186.05c requires specialized approaches for membrane proteins:

  • Lysis buffer optimization:

    • Test different detergent combinations (CHAPS, digitonin, or DDM at 0.5-1%)

    • Include moderate salt (150-300mM NaCl) to minimize non-specific interactions

    • Add calcium chelators (1mM EGTA) if studying calcium-dependent interactions

  • Cross-linking considerations:

    • For transient interactions, optimize formaldehyde (0.1-1%) or DSP cross-linking

    • Perform both native and cross-linked IPs to distinguish stable vs. transient interactions

  • Controls and validation:

    • Include IgG controls and SPAC186.05c deletion strains

    • Verify by both Western blot and mass spectrometry

In comparative studies, only 47% of monoclonal antibodies successfully captured recombinant proteins, while just 13% effectively immunoprecipitated endogenous proteins from cell lysates . This highlights the challenging nature of IP experiments and the need for rigorous optimization.

How can researchers apply computational approaches to develop improved antibodies against SPAC186.05c?

The RosettaAntibodyDesign (RAbD) framework offers a sophisticated approach for developing enhanced SPAC186.05c antibodies:

  • Initial structure preparation:

    • Start with existing antibody-antigen structures or generate computational models

    • Dock antibody templates to predicted antigenic epitopes on SPAC186.05c

    • Identify accessible regions in the native protein conformation

  • Design optimization process:

    • Sample diverse CDR structures from canonical clusters

    • Perform sequence design according to cluster-based amino acid profiles

    • Utilize flexible-backbone design with CDR constraints

    • Optimize either total Rosetta energy or interface energy

  • Selection and validation strategy:

    • Prioritize designs with favorable binding energy scores

    • Calculate design risk ratios (DRR) to assess native-like features

    • Express top candidates for experimental validation

RAbD has demonstrated the ability to improve antibody affinity by 10-50 fold in experimental validation , making it a valuable approach for generating enhanced SPAC186.05c antibodies with improved specificity and sensitivity.

How should researchers interpret SPAC186.05c expression changes across different experimental conditions?

When analyzing SPAC186.05c expression changes:

  • Normalization approaches:

    • For Western blot quantification, normalize to stable membrane protein references rather than cytosolic proteins

    • Consider VDAC, Na⁺/K⁺-ATPase, or total protein staining for normalization

    • For transcript analysis, use multiple reference genes and geometric mean normalization

  • Statistical analysis requirements:

    • Perform minimum three biological replicates

    • Apply appropriate statistical tests (t-test for two conditions, ANOVA for multiple conditions)

    • Calculate effect sizes and confidence intervals, not just p-values

  • Integrated data interpretation:

    • Compare protein-level changes with transcript data

    • Analyze potential post-translational modifications that may affect antibody binding

    • Consider protein half-life and degradation pathways in interpretation

Studies of S. pombe gene expression show that proteins in the "Swi6-bound" and "Up-stress" categories (which may include SPAC186.05c) often display expression changes that correlate with cellular stress responses . This context is important when interpreting experimental results.

What approaches can differentiate between specific and non-specific binding of SPAC186.05c antibodies?

Distinguishing specific from non-specific signals requires systematic controls:

  • Genetic controls:

    • Compare signal between wild-type and SPAC186.05c deletion strains

    • Use strains with tagged SPAC186.05c for co-localization studies

    • Analyze strains with SPAC186.05c overexpression

  • Biochemical controls:

    • Perform competitive inhibition with immunizing peptide

    • Use secondary antibody-only controls to identify background

    • Pre-adsorb antibody with lysates from deletion strains

  • Quantitative assessment metrics:

    • Calculate signal-to-noise ratios (>3 considered acceptable)

    • Compare band intensity profiles between specific and control samples

    • Perform quantitative proteomics validation by IP-MS

Studies indicate that antibody specificity assessment requires multiple orthogonal approaches, as single-method validation can miss cross-reactivity with structurally similar proteins .

How can researchers apply SPAC186.05c antibodies for studying protein-protein interactions?

To investigate SPAC186.05c protein interactions:

  • Co-immunoprecipitation approach:

    • Optimize lysis conditions specifically for membrane protein complexes

    • Consider mild detergents (digitonin 0.5-1%) to preserve interactions

    • Include appropriate controls (IgG, deletion strains)

    • Validate interactions with reciprocal IPs and mass spectrometry

  • Proximity labeling alternatives:

    • Generate SPAC186.05c fusion with BioID or TurboID

    • Perform proximity labeling in living cells

    • Identify biotinylated proteins via streptavidin pulldown and mass spectrometry

    • Compare interactome under different stress conditions

  • Advanced microscopy techniques:

    • Apply proximity ligation assays (PLA) for in situ interaction detection

    • Use split-fluorescent protein complementation assays

    • Combine with high-content imaging for quantitative analysis

Antibody-based protein interaction studies have shown varying success rates, with approximately 14% of monoclonal antibodies working effectively in protein array analyses .

What considerations are important when applying SPAC186.05c antibodies for chromatin studies?

For chromatin immunoprecipitation and related applications:

  • Epitope accessibility assessment:

    • Determine if SPAC186.05c associates with chromatin directly or indirectly

    • Test different fixation conditions (0.5-3% formaldehyde, 5-20 minutes)

    • Optimize sonication parameters for S. pombe chromatin (200-500bp fragments)

  • ChIP-specific controls:

    • Include input controls, IgG controls, and technical replicates

    • Perform ChIP-qPCR validation at predicted binding sites before sequencing

    • Compare with ChIP using tagged SPAC186.05c constructs

  • Data analysis approach:

    • Utilize peak calling algorithms appropriate for the expected binding pattern

    • Perform IDR (Irreproducible Discovery Rate) analysis between replicates

    • Correlate binding patterns with transcriptomic data and chromatin marks

According to studies on S. pombe chromatin proteins, factors in the Swi6-bound category often show distinctive localization patterns at heterochromatic regions, which might be relevant when characterizing SPAC186.05c chromatin association .

How can SPAC186.05c antibodies be applied in studying post-translational modifications?

For investigating post-translational modifications (PTMs) of SPAC186.05c:

  • Modification-specific antibody development:

    • Generate antibodies against predicted phosphorylation, ubiquitination, or glycosylation sites

    • Validate using corresponding PTM-deficient mutants

    • Compare with mass spectrometry-based PTM mapping

  • Enrichment strategies:

    • Combine SPAC186.05c immunoprecipitation with PTM-specific detection

    • Use sequential immunoprecipitation for PTM-specific pools

    • Apply peptide immunoaffinity enrichment followed by targeted mass spectrometry

  • Functional correlation:

    • Analyze PTM patterns under different stress conditions

    • Compare wild-type with kinase/phosphatase mutants

    • Correlate modifications with protein localization and activity

Studies using peptide immunoaffinity enrichment for targeted mass spectrometry have shown this approach to be particularly valuable for quantifying low-abundance modified proteins in complex samples .

What are common technical issues with SPAC186.05c antibodies and their solutions?

When working with antibodies against membrane proteins like SPAC186.05c, researchers commonly encounter these issues:

IssuePotential CausesSolutions
No signal in Western blotEpitope denaturation, insufficient extractionTry non-denaturing conditions, optimize membrane protein extraction
Multiple bandsCross-reactivity, protein degradationIncrease washing stringency, add protease inhibitors, validate with knockout controls
High backgroundNon-specific binding, insufficient blockingIncrease blocking (5-10% milk/BSA), optimize antibody dilution, add 0.1-0.2% SDS to wash buffer
Failed immunoprecipitationInaccessible epitope, harsh lysis conditionsTry different detergents, increase antibody amount, consider native conditions
Inconsistent resultsBatch variation, protein expression changesStandardize protocols, maintain reference samples, document lot numbers

Success rates for antibodies vary significantly across applications, with antibody validation studies showing only 34% working in Western blots against endogenous proteins and 13% working in IP-MS against endogenous proteins .

How should researchers approach batch-to-batch variation in SPAC186.05c antibodies?

Managing antibody batch variation requires systematic quality control:

  • Initial comparison protocol:

    • Perform side-by-side Western blots with old and new batches

    • Compare signal-to-noise ratio, band pattern, and intensity

    • Document optimal dilutions for each batch

    • Test in all intended applications before switching completely

  • Reference sample strategy:

    • Maintain aliquots of positive control samples (recombinant protein, responsive cell lysates)

    • Create standard curves with each new batch

    • Calculate correction factors between batches for quantitative studies

  • Documentation practices:

    • Record batch numbers and validation results

    • Include batch information in publications and protocols

    • Share validation data with colleagues

Consistent with antibody development studies, establishing validation protocols that include multiple applications and controls helps mitigate the impact of batch-to-batch variation .

What emerging technologies might enhance SPAC186.05c antibody applications?

Several cutting-edge approaches hold promise for SPAC186.05c research:

  • Single-domain antibodies and nanobodies:

    • Smaller size enhances epitope accessibility in membrane proteins

    • Greater stability in different buffer conditions

    • Potential for intracellular expression as functional inhibitors

  • Antibody engineering via machine learning:

    • Training neural networks on antibody-antigen interaction data

    • Predicting optimal binding configurations beyond RosettaAntibody approaches

    • Designing multi-specific antibodies for complex detection scenarios

  • CRISPR-based epitope tagging:

    • Precise endogenous tagging of SPAC186.05c

    • Complementary approach to validate antibody specificity

    • Potential for conditional epitope exposure systems

Computational antibody design frameworks like RAbD have shown significant improvements in antibody affinity (10-50 fold) through structure-based optimization approaches, suggesting similar enhancements may be possible for SPAC186.05c antibodies .

How might SPAC186.05c antibodies contribute to understanding conserved calcium transport mechanisms?

As a Gdt1-like protein, SPAC186.05c antibodies could facilitate comparative studies:

  • Evolutionary conservation analysis:

    • Compare localization and expression patterns across yeast species

    • Correlate structural features with functional conservation

    • Identify species-specific regulatory mechanisms

  • Stress response investigation:

    • Analyze SPAC186.05c expression under calcium stress conditions

    • Compare with other calcium transporters response patterns

    • Develop models of coordinated calcium homeostasis

  • Interactome mapping:

    • Identify conserved and divergent interaction partners

    • Compare with mammalian Gdt1 homologs (TMEM165)

    • Investigate potential roles in glycosylation pathways

Studies of gene expression in S. pombe indicate that membrane transporters often display coordinated expression changes under stress conditions, providing context for interpreting SPAC186.05c regulation .

What methodological advances could improve SPAC186.05c antibody specificity?

Enhancing antibody specificity for challenging targets like SPAC186.05c may benefit from:

  • Epitope-focused selection strategies:

    • Target regions with maximum sequence divergence from related proteins

    • Develop computational tools for optimal epitope prediction

    • Implement negative selection against cross-reactive epitopes

  • Combinatorial validation approaches:

    • Integrate multiple validation methods into standardized workflows

    • Develop quantitative scoring systems for antibody performance

    • Implement machine learning for predicting antibody specificity

  • Native conformation preservation:

    • Develop native antigen presentation methods for immunization

    • Utilize membrane mimetics (nanodiscs, liposomes) for screening

    • Implement conformational epitope mapping techniques

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.