The antibody is primarily used to study gene expression and protein localization in fission yeast. Key findings from studies include:
Role in Heterochromatin Regulation: SPAC186.05c is located in subtelomeric regions, which are associated with heterochromatin formation. Cohesin proteins (e.g., Mis4) influence the expression of subtelomeric genes like SPAC186.05c, as shown by transcriptome analyses in mis4-367 mutants .
Primer Design for Analysis: Primer sequences (Forward: AAATTTTCCCGGGCTTTCAT, Reverse: TCCGACAATCACCGCTACC) have been used in real-time PCR to quantify SPAC186.05c expression in chromatin immunoprecipitation (ChIP) assays .
Structure: Polyclonal antibodies like SPAC186.05c contain multiple paratopes targeting different epitopes of the antigen, enhancing detection sensitivity .
Fc Region: The antibody’s Fc region facilitates interactions with protein G agarose beads or ChIP-Adembeads for immunoprecipitation .
Applications in Protein Analysis:
In mis4-367 mutants, SPAC186.05c exhibited altered expression during temperature shifts, suggesting cohesin’s role in stabilizing subtelomeric heterochromatin domains .
| Gene | Fold Change | Function (Predicted) | Location |
|---|---|---|---|
| SPAC186.01 | 2.66 | Glycoprotein | Subtelomeric |
| SPAC186.02c | 2.93 | 2-Hydroxyacid dehydrogenase | Subtelomeric |
| SPAC186.05c | N/A | Not explicitly quantified | Subtelomeric |
Note: SPAC186.05c’s primers were used in ChIP assays, but its direct expression fold change was not reported .
Specificity: Validated via antigen-affinity purification and reactivity tests in Schizosaccharomyces pombe.
Cross-Reactivity: No reported cross-reactivity with other yeast species or human proteins .
KEGG: spo:SPAC186.05c
STRING: 4896.SPAC186.05c.1
Validation of SPAC186.05c antibodies requires a multi-tiered approach similar to that used for other S. pombe proteins:
Western blot validation:
Test against recombinant SPAC186.05c protein (positive control)
Compare signal between wild-type and SPAC186.05c deletion strains
Assess specificity via peptide competition assays
Specificity metrics:
Signal ratio between wild-type and knockout samples should exceed 10:1
Peptide competition should eliminate >90% of specific signal
Cross-reactivity with related proteins should be <10%
According to antibody development studies, approximately 53% of monoclonal antibodies show positive results against recombinant proteins in Western blots, while only 34% detect endogenous proteins in cell lines . These benchmarks should guide expectations when validating new SPAC186.05c antibodies.
SPAC186.05c antibodies can be applied across multiple experimental techniques:
| Application | Methodology | Success Rate* | Key Considerations |
|---|---|---|---|
| Western Blotting | Protein detection via SDS-PAGE and immunoblotting | 34% | Optimize blocking and antibody dilution |
| Immunoprecipitation | Protein complex isolation | 13% | Buffer composition critical for membrane proteins |
| Immunofluorescence | Subcellular localization | Variable | Fixation method affects epitope accessibility |
| ChIP-seq | Chromatin interaction analysis | Not determined | Crosslinking optimization critical |
| Protein Arrays | Interaction screening | 14% | Higher false positive/negative rates |
*Success rates based on similar monoclonal antibody development projects
For optimal Western blot detection of SPAC186.05c, researchers should implement this methodological approach:
Sample preparation:
Extract total protein from exponentially growing S. pombe cultures using a membrane-protein-optimized lysis buffer (50mM Tris-HCl pH 7.5, 150mM NaCl, 1% NP-40 or 1% Triton X-100, protease inhibitors)
Sonicate samples (3-5 pulses of 10 seconds) to ensure membrane protein solubilization
Heat samples at 70°C (not 95°C) for 10 minutes to prevent aggregation of transmembrane domains
Electrophoresis conditions:
Use 10-12% SDS-PAGE gels for optimal resolution
Load 20-50 μg total protein per lane
Include recombinant SPAC186.05c as positive control
Transfer and detection:
Transfer to PVDF membrane (preferred over nitrocellulose for hydrophobic proteins)
Block with 5% non-fat dry milk or BSA in TBST
Primary antibody dilution starting at 1:1000, incubating overnight at 4°C
Wash stringently (5-6 times, 10 minutes each)
This approach addresses the specific challenges of membrane protein detection and has shown higher success rates in antibody validation studies for similar proteins .
Successful immunoprecipitation of SPAC186.05c requires specialized approaches for membrane proteins:
Lysis buffer optimization:
Test different detergent combinations (CHAPS, digitonin, or DDM at 0.5-1%)
Include moderate salt (150-300mM NaCl) to minimize non-specific interactions
Add calcium chelators (1mM EGTA) if studying calcium-dependent interactions
Cross-linking considerations:
For transient interactions, optimize formaldehyde (0.1-1%) or DSP cross-linking
Perform both native and cross-linked IPs to distinguish stable vs. transient interactions
Controls and validation:
Include IgG controls and SPAC186.05c deletion strains
Verify by both Western blot and mass spectrometry
In comparative studies, only 47% of monoclonal antibodies successfully captured recombinant proteins, while just 13% effectively immunoprecipitated endogenous proteins from cell lysates . This highlights the challenging nature of IP experiments and the need for rigorous optimization.
The RosettaAntibodyDesign (RAbD) framework offers a sophisticated approach for developing enhanced SPAC186.05c antibodies:
Initial structure preparation:
Start with existing antibody-antigen structures or generate computational models
Dock antibody templates to predicted antigenic epitopes on SPAC186.05c
Identify accessible regions in the native protein conformation
Design optimization process:
Sample diverse CDR structures from canonical clusters
Perform sequence design according to cluster-based amino acid profiles
Utilize flexible-backbone design with CDR constraints
Optimize either total Rosetta energy or interface energy
Selection and validation strategy:
Prioritize designs with favorable binding energy scores
Calculate design risk ratios (DRR) to assess native-like features
Express top candidates for experimental validation
RAbD has demonstrated the ability to improve antibody affinity by 10-50 fold in experimental validation , making it a valuable approach for generating enhanced SPAC186.05c antibodies with improved specificity and sensitivity.
When analyzing SPAC186.05c expression changes:
Normalization approaches:
For Western blot quantification, normalize to stable membrane protein references rather than cytosolic proteins
Consider VDAC, Na⁺/K⁺-ATPase, or total protein staining for normalization
For transcript analysis, use multiple reference genes and geometric mean normalization
Statistical analysis requirements:
Perform minimum three biological replicates
Apply appropriate statistical tests (t-test for two conditions, ANOVA for multiple conditions)
Calculate effect sizes and confidence intervals, not just p-values
Integrated data interpretation:
Compare protein-level changes with transcript data
Analyze potential post-translational modifications that may affect antibody binding
Consider protein half-life and degradation pathways in interpretation
Studies of S. pombe gene expression show that proteins in the "Swi6-bound" and "Up-stress" categories (which may include SPAC186.05c) often display expression changes that correlate with cellular stress responses . This context is important when interpreting experimental results.
Distinguishing specific from non-specific signals requires systematic controls:
Genetic controls:
Compare signal between wild-type and SPAC186.05c deletion strains
Use strains with tagged SPAC186.05c for co-localization studies
Analyze strains with SPAC186.05c overexpression
Biochemical controls:
Perform competitive inhibition with immunizing peptide
Use secondary antibody-only controls to identify background
Pre-adsorb antibody with lysates from deletion strains
Quantitative assessment metrics:
Calculate signal-to-noise ratios (>3 considered acceptable)
Compare band intensity profiles between specific and control samples
Perform quantitative proteomics validation by IP-MS
Studies indicate that antibody specificity assessment requires multiple orthogonal approaches, as single-method validation can miss cross-reactivity with structurally similar proteins .
To investigate SPAC186.05c protein interactions:
Co-immunoprecipitation approach:
Optimize lysis conditions specifically for membrane protein complexes
Consider mild detergents (digitonin 0.5-1%) to preserve interactions
Include appropriate controls (IgG, deletion strains)
Validate interactions with reciprocal IPs and mass spectrometry
Proximity labeling alternatives:
Generate SPAC186.05c fusion with BioID or TurboID
Perform proximity labeling in living cells
Identify biotinylated proteins via streptavidin pulldown and mass spectrometry
Compare interactome under different stress conditions
Advanced microscopy techniques:
Apply proximity ligation assays (PLA) for in situ interaction detection
Use split-fluorescent protein complementation assays
Combine with high-content imaging for quantitative analysis
Antibody-based protein interaction studies have shown varying success rates, with approximately 14% of monoclonal antibodies working effectively in protein array analyses .
For chromatin immunoprecipitation and related applications:
Epitope accessibility assessment:
Determine if SPAC186.05c associates with chromatin directly or indirectly
Test different fixation conditions (0.5-3% formaldehyde, 5-20 minutes)
Optimize sonication parameters for S. pombe chromatin (200-500bp fragments)
ChIP-specific controls:
Include input controls, IgG controls, and technical replicates
Perform ChIP-qPCR validation at predicted binding sites before sequencing
Compare with ChIP using tagged SPAC186.05c constructs
Data analysis approach:
Utilize peak calling algorithms appropriate for the expected binding pattern
Perform IDR (Irreproducible Discovery Rate) analysis between replicates
Correlate binding patterns with transcriptomic data and chromatin marks
According to studies on S. pombe chromatin proteins, factors in the Swi6-bound category often show distinctive localization patterns at heterochromatic regions, which might be relevant when characterizing SPAC186.05c chromatin association .
For investigating post-translational modifications (PTMs) of SPAC186.05c:
Modification-specific antibody development:
Generate antibodies against predicted phosphorylation, ubiquitination, or glycosylation sites
Validate using corresponding PTM-deficient mutants
Compare with mass spectrometry-based PTM mapping
Enrichment strategies:
Combine SPAC186.05c immunoprecipitation with PTM-specific detection
Use sequential immunoprecipitation for PTM-specific pools
Apply peptide immunoaffinity enrichment followed by targeted mass spectrometry
Functional correlation:
Analyze PTM patterns under different stress conditions
Compare wild-type with kinase/phosphatase mutants
Correlate modifications with protein localization and activity
Studies using peptide immunoaffinity enrichment for targeted mass spectrometry have shown this approach to be particularly valuable for quantifying low-abundance modified proteins in complex samples .
When working with antibodies against membrane proteins like SPAC186.05c, researchers commonly encounter these issues:
| Issue | Potential Causes | Solutions |
|---|---|---|
| No signal in Western blot | Epitope denaturation, insufficient extraction | Try non-denaturing conditions, optimize membrane protein extraction |
| Multiple bands | Cross-reactivity, protein degradation | Increase washing stringency, add protease inhibitors, validate with knockout controls |
| High background | Non-specific binding, insufficient blocking | Increase blocking (5-10% milk/BSA), optimize antibody dilution, add 0.1-0.2% SDS to wash buffer |
| Failed immunoprecipitation | Inaccessible epitope, harsh lysis conditions | Try different detergents, increase antibody amount, consider native conditions |
| Inconsistent results | Batch variation, protein expression changes | Standardize protocols, maintain reference samples, document lot numbers |
Success rates for antibodies vary significantly across applications, with antibody validation studies showing only 34% working in Western blots against endogenous proteins and 13% working in IP-MS against endogenous proteins .
Managing antibody batch variation requires systematic quality control:
Initial comparison protocol:
Perform side-by-side Western blots with old and new batches
Compare signal-to-noise ratio, band pattern, and intensity
Document optimal dilutions for each batch
Test in all intended applications before switching completely
Reference sample strategy:
Maintain aliquots of positive control samples (recombinant protein, responsive cell lysates)
Create standard curves with each new batch
Calculate correction factors between batches for quantitative studies
Documentation practices:
Record batch numbers and validation results
Include batch information in publications and protocols
Share validation data with colleagues
Consistent with antibody development studies, establishing validation protocols that include multiple applications and controls helps mitigate the impact of batch-to-batch variation .
Several cutting-edge approaches hold promise for SPAC186.05c research:
Single-domain antibodies and nanobodies:
Smaller size enhances epitope accessibility in membrane proteins
Greater stability in different buffer conditions
Potential for intracellular expression as functional inhibitors
Antibody engineering via machine learning:
Training neural networks on antibody-antigen interaction data
Predicting optimal binding configurations beyond RosettaAntibody approaches
Designing multi-specific antibodies for complex detection scenarios
CRISPR-based epitope tagging:
Precise endogenous tagging of SPAC186.05c
Complementary approach to validate antibody specificity
Potential for conditional epitope exposure systems
Computational antibody design frameworks like RAbD have shown significant improvements in antibody affinity (10-50 fold) through structure-based optimization approaches, suggesting similar enhancements may be possible for SPAC186.05c antibodies .
As a Gdt1-like protein, SPAC186.05c antibodies could facilitate comparative studies:
Evolutionary conservation analysis:
Compare localization and expression patterns across yeast species
Correlate structural features with functional conservation
Identify species-specific regulatory mechanisms
Stress response investigation:
Analyze SPAC186.05c expression under calcium stress conditions
Compare with other calcium transporters response patterns
Develop models of coordinated calcium homeostasis
Interactome mapping:
Identify conserved and divergent interaction partners
Compare with mammalian Gdt1 homologs (TMEM165)
Investigate potential roles in glycosylation pathways
Studies of gene expression in S. pombe indicate that membrane transporters often display coordinated expression changes under stress conditions, providing context for interpreting SPAC186.05c regulation .
Enhancing antibody specificity for challenging targets like SPAC186.05c may benefit from:
Epitope-focused selection strategies:
Target regions with maximum sequence divergence from related proteins
Develop computational tools for optimal epitope prediction
Implement negative selection against cross-reactive epitopes
Combinatorial validation approaches:
Integrate multiple validation methods into standardized workflows
Develop quantitative scoring systems for antibody performance
Implement machine learning for predicting antibody specificity
Native conformation preservation:
Develop native antigen presentation methods for immunization
Utilize membrane mimetics (nanodiscs, liposomes) for screening
Implement conformational epitope mapping techniques