YNR077C is a yeast open reading frame (ORF) with uncharacterized function, annotated as a hypothetical protein. Its gene locus resides on chromosome XIV. Research involving this antibody has revealed:
Expression patterns: Upregulated in yeast strains with ∆2KTM Rpb1 mutations, as detected via RT-QPCR .
Associated pathways: Co-expressed with genes such as YFR057W and YCL074W under specific transcriptional stress conditions .
Western Blot: Validated for specificity using knockout (KO) yeast strains to confirm target recognition .
Immunoprecipitation: Used to isolate YNR077C for protein interaction studies .
RT-QPCR: Primer sequences for YNR077C amplification (Forward: GCGGCCCCAAATATTGTAT, Reverse: TGGTGGTGATTTTGTGGGTA) .
Specificity: Demonstrated by clean band detection at the expected molecular weight (~50 kDa) in wild-type lysates, absent in KO controls .
Cross-reactivity: No observed binding to homologous proteins in Schizosaccharomyces pombe or Ashbya gossypii .
Functional ambiguity: The biological role of YNR077C remains uncharacterized, necessitating further studies on its interactome .
Commercial challenges: Limited citation in peer-reviewed literature raises questions about reproducibility across experimental conditions .
YNR077C is a yeast gene that has been studied in the context of gene expression regulation and cellular response mechanisms. Expression of YNR077C has been observed to increase under specific genetic conditions, making it a valuable target for studying regulatory pathways in yeast . Antibodies against YNR077C are important research tools that enable the detection, quantification, and isolation of this protein in experimental systems. These antibodies facilitate studies on protein localization, interaction networks, and functional characterization, contributing to our understanding of yeast biology and potentially broader cellular mechanisms.
Validation of YNR077C antibodies typically involves multiple complementary approaches. Western blotting is essential to confirm antibody specificity by demonstrating a single band of the expected molecular weight. Immunoprecipitation followed by mass spectrometry provides additional confirmation of target specificity. For YNR077C specifically, validation should include:
Testing in wild-type yeast strains versus YNR077C knockout strains
Analyzing cross-reactivity with similar yeast proteins
Evaluating performance across different experimental conditions
Confirming recognition of both native and denatured forms as appropriate
RNA isolation and RT-QPCR can be used to correlate protein detection with gene expression levels . Chromatin immunoprecipitation (ChIP) analysis can further validate antibody performance in more complex applications .
Studies have shown that YNR077C expression can be induced under specific genetic conditions. For example, research has documented increased expression of YNR077C along with YFR057W and YCL074W in the presence of the ∆2KTM Rpb1 mutant . This suggests that YNR077C may be regulated through mechanisms involving RNA polymerase II and potentially plays a role in stress response pathways. Antibodies against YNR077C are valuable tools for tracking these expression changes at the protein level.
Several approaches can be employed to generate high-quality antibodies against YNR077C:
Hybridoma Technology: This established method involves immunizing mice or Armenian hamsters with purified YNR077C protein or peptides derived from its sequence. Once sufficient antibody titers are identified, splenocytes are fused with murine myeloma cells to create hybridomas that secrete monoclonal antibodies. These hybridomas are then screened, subcloned, and stabilized to establish cell lines producing antibodies with defined specificity and isotype .
Recombinant Antibody Libraries: Technologies like HuCAL® can generate fully human recombinant monoclonal antibodies through phage display. This approach offers greater flexibility during production and opportunities for optimization such as affinity maturation and conversion to different formats .
Yeast Display Technology: This emerging method combines antibody discovery with yeast biology, making it particularly relevant for generating antibodies against yeast proteins like YNR077C. The technique involves displaying antibody fragments on the surface of yeast cells, allowing for efficient library screening through methods like FACS to identify high-affinity binders .
Generating specific antibodies against yeast proteins like YNR077C presents several challenges:
Antigen Design Strategy: Select unique regions of YNR077C with low homology to other yeast proteins. Computational analysis of sequence conservation and structural prediction can guide selection of optimal epitopes.
Cross-Adsorption Techniques: During antibody screening, include lysates from YNR077C knockout strains to remove antibodies that bind non-specifically to other yeast proteins.
Affinity Maturation: For recombinant antibodies, implement affinity maturation processes to enhance binding specificity and reduce cross-reactivity .
Negative Selection Strategies: When using display technologies, incorporate negative selection steps with closely related proteins to eliminate cross-reactive antibodies.
Validation in Multiple Assays: Test antibody performance in multiple assay formats (ELISA, Western blot, immunoprecipitation, ChIP) to ensure consistent specificity across applications.
Optimized ChIP protocols for YNR077C antibodies should include:
Crosslinking Optimization: Standard formaldehyde crosslinking (1% for 10 minutes) is typically effective for most yeast proteins, but optimization may be necessary for YNR077C depending on its cellular localization and chromatin association properties.
Sonication Parameters: Chromatin should be sonicated to fragments of 200-500 bp for optimal immunoprecipitation. Verification of fragmentation efficiency by gel electrophoresis is essential.
Antibody Incubation: Incubate chromatin with YNR077C antibody overnight at 4°C using 2-5 μg of antibody per ChIP reaction.
Controls and Normalization: Include proper controls such as IgG negative controls and normalization to intergenic regions (e.g., the intergenic VL primer set described in the literature) .
Quantification Method: Quantify precipitated DNA by qPCR using gene-specific primers, normalizing signals to input DNA and an intergenic control region.
Research has demonstrated successful ChIP protocols for examining association of proteins with specific gene regions in yeast, including those related to YNR077C, YFR057W, and YCL074W, using primer sequences such as:
Machine learning approaches offer innovative ways to improve antibody development and characterization for targets like YNR077C:
Prediction of Antibody-Antigen Binding: Machine learning models can analyze many-to-many relationships between antibodies and antigens to predict binding interactions. This can guide the selection of optimal antibody candidates for YNR077C .
Active Learning for Experimental Design: Active learning strategies can significantly reduce experimental costs by starting with a small labeled subset of data and iteratively expanding the dataset. Research has shown that well-designed active learning algorithms can reduce the number of required antigen mutant variants by up to 35% compared to random sampling approaches .
Out-of-Distribution Prediction: Advanced algorithms can address challenges in predicting interactions when test antibodies and antigens are not represented in training data. This is particularly valuable when working with novel targets like YNR077C where comprehensive binding data may be limited .
Optimization of Screening Protocols: Machine learning can identify patterns in screening data to optimize the selection of hybridoma clones with the highest specificity and affinity for YNR077C.
Anti-idiotypic antibodies—antibodies that bind to the variable region (idiotype) of another antibody—can serve several important functions in YNR077C antibody research:
YNR077C antibodies can complement RNA-seq and transcriptomic studies through several approaches:
Correlation of Protein and mRNA Levels: By combining RNA-seq data with protein detection using YNR077C antibodies, researchers can investigate the relationship between transcription and translation for this gene. This integration can reveal post-transcriptional regulatory mechanisms.
ChIP-seq Applications: YNR077C antibodies can be used in ChIP-seq experiments to map genome-wide binding sites if YNR077C has DNA-binding properties or associates with chromatin, providing insights into its potential regulatory functions.
RIP-seq Integration: If YNR077C interacts with RNA, antibodies can be used in RNA immunoprecipitation sequencing (RIP-seq) to identify associated transcripts.
Validation of Differential Expression: YNR077C antibodies can validate RNA-seq findings at the protein level, particularly in studies where differential expression has been observed, such as the increased expression documented in the presence of the ∆2KTM Rpb1 mutant .
RNA-seq data processing for such integrative analyses typically involves:
Quality control using tools like QC3
Alignment to the reference genome (e.g., sacCer2) using TopHat2
Quantification of gene expression and differential expression analysis using Cufflinks
Yeast display technology can be effectively leveraged with YNR077C antibodies through the following approaches:
Library Construction: Generate a diverse antibody library displayed on yeast surface by cloning variable region genes into yeast display vectors. This technique is particularly valuable for studying antibody-antigen interactions in the yeast environment.
Selection and Screening: Use fluorescence-activated cell sorting (FACS) to identify yeast cells displaying antibodies with high affinity for YNR077C. Multiple rounds of selection with decreasing antigen concentrations can isolate high-affinity binders.
Characterization of Binding Properties: Analyze binding kinetics using flow cytometry by incubating yeast-displayed antibodies with varying concentrations of fluorescently labeled YNR077C.
Epitope Mapping: Yeast display can be used for epitope mapping by testing binding against truncated or mutated versions of YNR077C to identify the precise binding region.
Training in yeast display technology, such as the course offered at the Institute for Protein Innovation (IPI), provides hands-on experience with library preparation, magnetic-activated cell sorting (MACS), fluorescence-activated cell sorting (FACS), and next-generation sequencing (NGS) sample preparation—all valuable skills for YNR077C antibody research .
Researchers frequently encounter several challenges when working with antibodies against yeast proteins like YNR077C:
Cross-reactivity Issues:
Problem: Antibodies may cross-react with similar yeast proteins.
Solution: Perform extensive validation using knockout strains, pre-adsorb antibodies against lysates from YNR077C deletion strains, and include competitive binding assays with purified recombinant YNR077C.
Low Signal-to-Noise Ratio:
Problem: High background or weak specific signal in immunoassays.
Solution: Optimize blocking conditions (consider 5% BSA instead of milk for yeast applications), increase washing stringency, and titrate antibody concentration carefully.
Inconsistent Performance Across Applications:
Problem: An antibody may work well in Western blot but poorly in immunoprecipitation.
Solution: Verify antibody recognition of native vs. denatured forms of YNR077C and optimize buffer conditions for each application.
Batch-to-Batch Variability:
Problem: Performance differences between antibody batches.
Solution: Use recombinant monoclonal antibodies which offer greater consistency than traditional hybridoma-derived antibodies , and implement rigorous quality control testing for each batch.
Fixation Sensitivity:
Problem: Some epitopes may be masked by certain fixation methods.
Solution: Test multiple fixation protocols (formaldehyde, methanol, acetone) to determine optimal conditions for YNR077C detection.
Quality assessment of YNR077C antibodies should include a comprehensive testing regimen:
Specificity Testing:
Western blot analysis comparing wild-type and YNR077C knockout strains
Immunoprecipitation followed by mass spectrometry to confirm target identity
Competitive binding assays with purified YNR077C protein
Sensitivity Assessment:
Titration experiments to determine lower limits of detection
Signal-to-noise ratio evaluation across multiple experimental conditions
Functional Validation:
Performance testing in relevant applications (ChIP, immunofluorescence, etc.)
Correlation of results with orthogonal methods (e.g., RNA expression data)
Stability Testing:
Freeze-thaw cycle testing to ensure antibody performance is maintained
Long-term storage stability assessment at recommended conditions
Mycoplasma Screening:
Isotype Determination:
YNR077C antibodies can be valuable tools in epigenetic studies of yeast chromatin through several approaches:
ChIP-seq for Histone Modifications: YNR077C antibodies can be used alongside antibodies against histone modifications (e.g., H4K16ac) to investigate potential correlations between YNR077C localization and specific epigenetic marks .
Sequential ChIP (Re-ChIP): This technique can determine if YNR077C co-localizes with specific transcription factors or chromatin modifiers by performing sequential immunoprecipitations.
Integration with DNA Adenine Methyltransferase Identification (DamID): YNR077C can be fused with Dam methyltransferase to map its chromatin associations without antibodies. This approach complements antibody-based methods and can provide validation of ChIP results .
Correlation with Chromatin State: ChIP data using YNR077C antibodies can be correlated with chromatin accessibility data (e.g., ATAC-seq) to understand the relationship between YNR077C binding and chromatin state.
Researchers have successfully employed similar approaches with yeast proteins, as evidenced by studies using ChIP analysis with gene-specific primers for YNR077C and other yeast genes .
Effective multiplexing strategies include:
Multicolor Immunofluorescence: Combine fluorescently-labeled YNR077C antibodies with antibodies against other proteins of interest using distinct fluorophores. This approach allows simultaneous detection of multiple proteins in the same yeast cells.
ChIP-seq with Multiple Antibodies: Sequential or parallel ChIP experiments using YNR077C antibodies alongside antibodies against histone modifications (such as H4K16ac) or RNA polymerase II phospho-CTD (Ser-5) can reveal functional relationships.
Mass Cytometry (CyTOF): This technique uses antibodies labeled with heavy metal isotopes instead of fluorophores, allowing simultaneous detection of dozens of proteins with minimal spectral overlap.
Proximity Ligation Assay (PLA): This method can detect protein-protein interactions involving YNR077C by generating fluorescent signals only when two target proteins are in close proximity.
Integration with RNA Analysis: Combining YNR077C protein detection with RNA FISH (Fluorescence In Situ Hybridization) allows correlation between protein localization and specific RNA transcripts.
Robust statistical analysis is crucial for interpreting data from YNR077C antibody experiments:
Normalization Strategies:
Statistical Tests for Significance:
For comparing two conditions, t-tests with appropriate corrections for multiple testing
For multiple conditions, ANOVA followed by post-hoc tests
For ChIP-seq data, specialized tools like MACS2 for peak calling and differential binding analysis
Reproducibility Assessment:
Calculate coefficient of variation across technical and biological replicates
Perform correlation analysis between replicates to ensure consistency
Integration with Transcriptomic Data:
Machine learning offers powerful approaches for extracting insights from complex antibody-based experimental data:
Epitope Prediction: Machine learning algorithms can predict antigenic determinants on YNR077C, guiding antibody development and epitope mapping.
Active Learning for Experimental Design: Active learning strategies can reduce experimental costs by identifying the most informative experiments to perform next. Studies have shown that well-designed active learning algorithms can significantly outperform random sampling approaches, reducing the number of required experiments by up to 35% .
Image Analysis in Immunofluorescence: Deep learning models can analyze immunofluorescence images to quantify YNR077C localization, co-localization with other proteins, and changes in response to experimental conditions.
Binding Affinity Prediction: Machine learning models can predict antibody-antigen binding affinities, helping to select optimal antibodies for specific applications. These models analyze many-to-many relationships between antibodies and antigens, improving prediction accuracy for out-of-distribution scenarios .
Integration of Multi-omics Data: Advanced algorithms can integrate antibody-based protein detection with transcriptomic, proteomic, and phenotypic data to build comprehensive models of YNR077C function in yeast biology.
Single-cell technologies open new avenues for YNR077C research:
Single-Cell Protein Analysis: Mass cytometry (CyTOF) using YNR077C antibodies can quantify protein levels in thousands of individual yeast cells, revealing cell-to-cell heterogeneity in expression.
Spatial Transcriptomics Integration: Combining YNR077C antibody staining with spatial transcriptomics can correlate protein localization with local gene expression patterns.
Single-Cell Proteogenomics: Integrating single-cell RNA-seq with antibody-based protein detection allows correlation between transcription and translation at the single-cell level.
Microfluidic Applications: Droplet-based microfluidic systems can isolate individual yeast cells for high-throughput screening of YNR077C antibodies against large cell populations.
Live-Cell Imaging: Using labeled YNR077C antibody fragments in live-cell imaging can track protein dynamics in real-time at the single-cell level.
Several cutting-edge approaches in antibody engineering have potential applications for YNR077C research:
Synthetic Antibody Libraries: Next-generation synthetic libraries with optimized frameworks offer improved stability and expression, potentially enhancing YNR077C antibody development.
AI-Driven Antibody Design: Artificial intelligence platforms can design antibodies with enhanced specificity for YNR077C by predicting optimal CDR sequences based on target structure.
Nanobodies and Single-Domain Antibodies: These smaller antibody formats offer advantages for intracellular applications and may improve access to sterically hindered epitopes on YNR077C.
Site-Specific Conjugation: Advanced conjugation chemistries enable precise attachment of labels or payloads to antibodies without compromising binding properties.
Bispecific Antibodies: Engineering antibodies that simultaneously bind YNR077C and another target of interest could enable novel experimental approaches to study protein interactions.
Yeast Display Technology: This technique combines antibody discovery with yeast biology and offers advantages for developing antibodies against yeast proteins like YNR077C through laboratory training programs and established protocols .