YOR314W Antibody

What is YOR314W and what cellular functions does the encoded protein perform?

YOR314W encodes Asr1 (Alcohol Sensitive RING/PHD finger 1), a ubiquitin ligase that plays antagonistic roles in silencing with other proteins such as Ubp3. The protein contains a functional RING finger domain essential for its ubiquitin ligase activity. Asr1 is involved in several cellular processes, particularly in gene silencing through its ubiquitylation activity .

Research has demonstrated that Asr1 specifically opposes the function of Ubp3 (a deubiquitylating enzyme) in controlling subtelomeric gene silencing. This was evidenced through assays using URA3 and ADE2 reporters, where deletion of UBP3 increased telomere-proximal silencing, while simultaneous deletion of ASR1 reversed this increase . This antagonistic relationship highlights the protein's role in maintaining the balance of gene expression at telomeric regions.

Asr1 also functions in the ubiquitylation pathway, which is integral to various cellular processes including protein degradation, cell cycle control, and transcriptional regulation . The ubiquitylation function of Asr1 requires its intact RING finger domain, as mutations in this domain eliminate its activity.

How are YOR314W antibodies typically generated and validated?

YOR314W antibodies are typically generated through standard monoclonal or polyclonal antibody production techniques. For monoclonal antibodies, this involves immunizing mice or rabbits with purified Asr1 protein or synthetic peptides derived from unique regions of the protein sequence.

For proper validation, researchers should follow a systematic approach similar to FDA guidelines for monoclonal antibodies:

• Structural Integrity Testing: Using techniques like SDS-PAGE, IEF, HPLC, or mass spectrometry to ensure the antibody is not fragmented, aggregated, or otherwise modified .

• Specificity Validation:

  • Direct binding assays with positive and negative controls

  • Use of isotype-matched, irrelevant antibodies as negative controls

  • When possible, determination of the specific epitope recognized by the antibody

• Cross-reactivity Screening: Testing against human tissues or other yeasts to ensure specificity .

• Functional Validation: Demonstrating the antibody's ability to recognize the target in relevant experimental contexts (western blotting, immunoprecipitation, etc.).

When validating YOR314W antibodies, researchers should include wild-type yeast samples alongside ∆asr1 deletion strains as critical controls to confirm specificity.

What techniques are commonly used with YOR314W antibodies to study Asr1's protein interactions?

Several techniques are routinely employed to study Asr1's protein interactions using YOR314W antibodies:

• Coimmunoprecipitation (Co-IP): This is the gold standard for studying protein-protein interactions. The protocol typically involves:

  • Harvesting 100 mL cultures of yeast

  • Preparing lysates by bead beating in yeast lysis buffer (0.1% Nonidet P-40, 10 mM phosphate buffer, pH 8.0, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1 mM Na₃VO₄) with freshly added protease inhibitors

  • Incubating with YOR314W antibody for 3 hours

  • Capturing immune complexes on Protein G Sepharose

  • Washing extensively in yeast lysis buffer

  • Eluting by boiling in SDS/PAGE loading buffer

  • Analyzing by SDS-PAGE and immunoblotting

• Chromatin Immunoprecipitation (ChIP): For studying Asr1's association with chromatin and its role in gene silencing.

• Two-Hybrid Analysis: Systematic two-hybrid screens can identify potential interaction partners for further validation with antibody-based methods .

• Immunofluorescence Microscopy: For studying Asr1's cellular localization and co-localization with interaction partners.

The choice of technique depends on the specific research question, with Co-IP being particularly valuable for confirming direct protein-protein interactions identified through other screening methods.

How should researchers interpret results from RT-qPCR experiments using YOR314W antibodies in chromatin studies?

When interpreting RT-qPCR results in studies involving YOR314W antibodies for chromatin immunoprecipitation (ChIP) experiments, researchers should consider several methodological aspects:

• Primer Selection and Controls: Use validated primers for target genes known to be regulated by Asr1, such as PHO12, PHO84, and PHO89 (telomere-proximal genes shown to be affected by Asr1 activity). Example primer sequences used in published research include:

  • PHO12: GGTGGTTCTGGGCCATACTA and TTCACCGTGTCTACCAACCA

  • PHO84: GACCGCTTTGTTCTGTGTCA and TTGGACCGAAGTTTTGGAAG

  • PHO89: TTGCATTTTTGGATGCCTTT and GGGTCGTTGGTAAAAATGGA

  • ACT1 (control): GACGCTCCTCGTGCTGTCTT and GTCTTTTTGACCCATACCGACC

• Data Normalization: Always normalize gene expression data to a housekeeping gene like ACT1 that is not affected by Asr1 activity.

• Strain Comparisons: Compare expression patterns across multiple strain backgrounds:

  • Wild-type

  • ∆asr1 (deletion)

  • Asr1 RINGm (RING finger mutation)

  • ∆ubp3 (Ubp3 deletion)

  • ∆ubp3∆asr1 (double deletion)

This comprehensive comparison helps elucidate the antagonistic relationship between Asr1 and Ubp3 in gene silencing, as demonstrated in previous research .

What methodological approaches can improve specificity in Asr1 immunoprecipitation experiments?

Enhancing specificity in Asr1 immunoprecipitation experiments requires careful optimization of several parameters:

• Epitope Tagging Strategy: When possible, use epitope-tagged Asr1 constructs (FLAG, MYC, or HA tags) expressed at physiological levels from the native promoter. This allows the use of highly specific commercial antibodies against the tag. Previous research has successfully used:

  • α-FLAG M2-HRP (A8592; Sigma)

  • M2 affinity gel (A2220; Sigma)

  • α-MYC 9E10 (Vanderbilt Molecular Biology Core)

  • α-HA 12CA5 (Cold Spring Harbor Monoclonal Shared Resource)

• Buffer Optimization: The composition of lysis and wash buffers significantly impacts specificity. The standard yeast lysis buffer (0.1% Nonidet P-40, 10 mM phosphate buffer, pH 8.0, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1 mM Na₃VO₄) should be supplemented with freshly prepared protease inhibitors:

  • 1 Complete tablet (Roche) per 50 mL

  • 130 μL of 0.5 M benzamidine (Sigma) per 50 mL

  • 500 μL of 0.1 M PMSF (Life Technologies) per 50 mL

• Cross-linking Considerations: For studying transient interactions, consider mild formaldehyde cross-linking (0.1-0.3%) before cell lysis.

• Sequential Immunoprecipitation: For studying specific complexes, perform sequential immunoprecipitation with antibodies against Asr1 followed by antibodies against the suspected interaction partner.

• Negative Controls: Always include multiple controls:

  • IgG isotype control

  • Immunoprecipitation from ∆asr1 deletion strains

  • Immunoprecipitation using an unrelated antibody of the same isotype

These methodological refinements help distinguish genuine interactions from background and ensure reproducibility across experiments.

How can researchers use YOR314W antibodies to study the antagonistic relationship between Asr1 and Ubp3?

The antagonistic relationship between Asr1 and Ubp3 in gene silencing represents a fascinating regulatory mechanism that can be thoroughly investigated using YOR314W antibodies through several approaches:

• Genetic Interaction Analysis Combined with Immunoblotting:

  • Create single and double mutant strains (∆asr1, ∆ubp3, ∆asr1∆ubp3)

  • Use YOR314W antibodies to confirm protein expression levels in these strains

  • Perform silencing assays (e.g., URA3 reporter with FOA resistance or ADE2 red/white colony assays)

  • Correlate protein levels with silencing phenotypes

• Domain-Specific Function Analysis:

  • Previous research showed that the N-terminal 145 and 180 amino acids of Ubp3 (∆N145 and ∆N180 mutants) maintained wild-type activity in certain phenotypes but affected interaction with Asr1

  • Use Co-IP with YOR314W antibodies to determine how specific domains mediate the Asr1-Ubp3 interaction

• Chromatin Immunoprecipitation (ChIP) Analysis:

  • Use YOR314W antibodies to perform ChIP at telomere-proximal genes in different genetic backgrounds

  • Combine with antibodies against histone modifications (e.g., α-H4K16ac) to correlate chromatin states with Asr1/Ubp3 activity

• Ubiquitylation Status Assessment:

  • Use YOR314W antibodies in denaturing immunoprecipitation to pull down Asr1

  • Probe with anti-ubiquitin antibodies to detect changes in substrate ubiquitylation in ∆ubp3 vs. wild-type backgrounds

These methodologies allow researchers to dissect the molecular mechanisms underlying the opposition between ubiquitylation by Asr1 and deubiquitylation by Ubp3 in regulating gene silencing.

What is the recommended experimental design for studying post-translational modifications of Asr1 using YOR314W antibodies?

For comprehensive analysis of Asr1 post-translational modifications (PTMs), researchers should implement a multi-technique experimental strategy:

• Immunoprecipitation Coupled with Mass Spectrometry:

  • Perform large-scale immunoprecipitation using YOR314W antibodies

  • Separate proteins by SDS-PAGE and extract Asr1 bands

  • Digest with trypsin and analyze by LC-MS/MS

  • Use database search algorithms that include common PTMs (phosphorylation, ubiquitylation, SUMOylation)

• PTM-Specific Antibody Detection:

  • After immunoprecipitation with YOR314W antibodies, probe with antibodies against specific modifications:

    • Anti-phospho-serine/threonine/tyrosine

    • Anti-ubiquitin (K48-linked vs. K63-linked chains)

    • Anti-SUMO

• Phosphatase/Deubiquitylase Treatment Controls:

  • Split immunoprecipitated samples and treat with:

    • Lambda phosphatase (for phosphorylation)

    • USP2 catalytic domain (for ubiquitylation)

    • SENP1 (for SUMOylation)

  • Compare treated vs. untreated samples to confirm PTM specificity

• Mutational Analysis:

  • Create point mutations at putative modification sites

  • Immunoprecipitate with YOR314W antibodies and compare PTM patterns

  • Correlate changes in modification with functional outcomes in silencing assays

• Cell Cycle and Stress Condition Analysis:

  • Synchronize cells or apply stress conditions

  • Immunoprecipitate Asr1 at different timepoints

  • Monitor changes in PTM patterns to correlate with cellular state

This comprehensive approach will provide a detailed map of Asr1 modifications and their functional significance in various cellular contexts.

How do different environmental stressors affect Asr1 expression and function as detected by YOR314W antibodies?

Asr1 (Alcohol Sensitive RING/PHD finger 1) was initially identified through its role in the cellular response to alcohol stress, but its function extends to various stress responses. Researchers can systematically investigate these responses using YOR314W antibodies through the following methodological approach:

• Stress Exposure Protocol:

  • Expose yeast cultures to different stressors:

    • Alcohol stress (ethanol 6-12%)

    • Oxidative stress (H₂O₂ 0.5-5 mM)

    • Osmotic stress (NaCl 0.4-1.0 M)

    • Nutrient limitation (nitrogen or carbon depletion)

    • DNA damage (MMS 0.02-0.1%)

    • Rapamycin treatment (100 nM)

• Time-Course Analysis:

  • Collect samples at multiple timepoints (0, 15, 30, 60, 120, 240 minutes)

  • Perform western blotting with YOR314W antibodies to track Asr1 protein levels

  • Quantify band intensity normalized to loading controls (e.g., Act1)

• Subcellular Localization Changes:

  • Use YOR314W antibodies for immunofluorescence microscopy

  • Track changes in Asr1 localization in response to different stressors

  • Quantify nuclear vs. cytoplasmic distribution

• Protein-Protein Interaction Dynamics:

  • Perform co-immunoprecipitation with YOR314W antibodies under different stress conditions

  • Identify stress-specific interaction partners

  • Correlate with functional outcomes

• Correlation with Gene Expression:

  • Perform ChIP with YOR314W antibodies followed by qPCR or sequencing

  • Analyze changes in Asr1 chromatin association during stress

  • Correlate with RT-qPCR analysis of target genes

This systematic approach enables researchers to establish a comprehensive understanding of how Asr1 functions as part of the cellular stress response network.

What considerations are important when conjugating YOR314W antibodies for advanced imaging applications?

When conjugating YOR314W antibodies for advanced imaging applications such as super-resolution microscopy or multiplexed imaging, researchers should consider several critical factors:

• Conjugation Chemistry Selection:

  • For fluorophore conjugation, NHS esters are commonly used for primary amines on antibodies

  • Maleimide chemistry targets reduced disulfides for site-specific labeling

  • Click chemistry approaches (azide-alkyne) offer high specificity with minimal background

• Antibody-to-Label Ratio Optimization:

  • The degree of labeling (DOL) must be carefully controlled

  • Determine the average ratio of coupled material to antibody

  • Excessive labeling can compromise antibody binding activity

  • For YOR314W antibodies, a DOL of 2-4 typically preserves function while providing sufficient signal

• Validation Requirements:

  • Post-conjugation specificity testing is essential

  • Compare immunoprecipitation efficiency before and after conjugation

  • Conduct side-by-side imaging with unconjugated antibody plus secondary detection

  • Test in both wild-type and ∆asr1 strains to confirm specificity

• Purification Considerations:

  • Remove unreacted dyes thoroughly (size exclusion chromatography or extensive dialysis)

  • Determine percent of free label in final preparation

  • Establish quality control criteria for each batch (typically <5% free label is acceptable)

• Storage and Stability:

  • Test stability under different storage conditions

  • Monitor potential aggregation using dynamic light scattering

  • Establish shelf-life through periodic functional testing

  • Consider adding stabilizers such as BSA or glycerol

Following these guidelines ensures that conjugated YOR314W antibodies maintain their specificity and functionality while providing optimal imaging performance in advanced microscopy applications.

How can YOR314W antibodies be utilized in quantitative proteomics workflows?

YOR314W antibodies can be integrated into quantitative proteomics workflows to study Asr1 complexes and their dynamics through several sophisticated approaches:

• Immunoprecipitation-Mass Spectrometry (IP-MS):

  • Perform immunoprecipitation with YOR314W antibodies from wild-type and control strains

  • Process samples for bottom-up proteomics analysis using LC-MS/MS

  • Apply label-free quantification or isotope labeling strategies (SILAC, TMT, iTRAQ)

  • Use statistical analysis to identify specific interactors versus background

• Proximity-Dependent Labeling:

  • Create fusion proteins of Asr1 with proximity labeling enzymes (BioID, APEX2, TurboID)

  • Use YOR314W antibodies to confirm expression and localization of fusion proteins

  • Identify proximal proteins through streptavidin pulldown and MS analysis

  • Validate key interactions using traditional co-immunoprecipitation with YOR314W antibodies

• Cross-Linked Immunoprecipitation-MS (XL-IP-MS):

  • Apply protein cross-linkers (DSS, BS3, formaldehyde) to stabilize transient interactions

  • Immunoprecipitate complexes with YOR314W antibodies

  • Identify cross-linked peptides using specialized MS methods and software

  • Map interaction interfaces at amino acid resolution

• Targeted Proteomics for PTM Analysis:

  • Develop Selected/Multiple Reaction Monitoring (SRM/MRM) methods for Asr1 peptides

  • Include modified peptides (phosphorylation, ubiquitylation) in the targeted assay

  • Quantify changes in modification status under different conditions

  • Correlate modifications with functional outcomes in silencing assays

These approaches provide complementary data on Asr1 interaction networks and their regulation, allowing researchers to build comprehensive models of Asr1 function in gene silencing and other cellular processes.

What critical controls should be included when using YOR314W antibodies for chromatin immunoprecipitation sequencing (ChIP-seq)?

ChIP-seq with YOR314W antibodies requires rigorous controls to ensure data reliability and biological relevance:

• Input Controls:

  • Process non-immunoprecipitated chromatin from the same sample

  • Use for normalization of ChIP signals and identification of artifacts

  • Sequence at similar depth as ChIP samples (minimum 20 million uniquely mapped reads)

• Antibody Validation Controls:

  • Perform ChIP in wild-type and ∆asr1 deletion strains

  • Peaks present in wild-type but absent in deletion strain confirm specificity

  • Include immunoprecipitation with pre-immune serum or IgG isotype control

  • For epitope-tagged Asr1, include untagged strain as control

• Spike-in Normalization Controls:

  • Add chromatin from a different species (e.g., S. pombe in S. cerevisiae experiments)

  • Use species-specific antibody against a housekeeping factor

  • Normalize between samples based on recovery of spike-in material

• Biological Relevance Controls:

  • Perform parallel ChIP-seq with antibodies against known interactors

  • Include antibodies against relevant histone modifications (e.g., α-H4K16ac)

  • Correlate ChIP-seq peaks with RNA-seq data from same conditions

  • Compare Asr1 binding sites with known silenced regions (e.g., telomere-proximal genes)

• Technical Validation Experiments:

  • Confirm selected peaks by ChIP-qPCR with primers for:

    • High-confidence peaks

    • Borderline peaks

    • Negative regions

  • Test multiple biological replicates (minimum three)

  • Include positive control regions (known Asr1 targets like PHO12, PHO84, PHO89)

Following these control guidelines ensures that ChIP-seq data with YOR314W antibodies provides reliable insights into the genomic distribution and function of Asr1.

How does phosphorylation status affect Asr1 function and antibody recognition?

Phosphorylation is a key regulatory mechanism that can modulate Asr1 function, and researchers studying this modification should consider its impact on antibody recognition and experimental design:

• Phosphorylation Sites and Functional Consequences:

  • Multiple serine/threonine residues in Asr1 can be phosphorylated

  • Phosphorylation may affect:

    • RING finger domain activity

    • Protein-protein interactions, particularly with Ubp3

    • Nuclear localization and chromatin association

    • Protein stability and turnover

• Antibody Recognition Challenges:

  • Standard YOR314W antibodies may have variable affinity for phosphorylated vs. non-phosphorylated forms

  • Phosphorylation near the epitope can significantly alter antibody binding

  • Researchers should test recognition efficiency using:

    • Lambda phosphatase-treated samples vs. untreated controls

    • Phosphomimetic mutants (S→D, T→E) vs. phospho-dead mutants (S→A, T→A)

• Recommended Analytical Approach:

  • Use phospho-specific antibodies in combination with general YOR314W antibodies

  • Perform immunoprecipitation under native conditions with YOR314W antibodies

  • Analyze immunoprecipitated material by:

    • Phospho-specific western blotting

    • Phos-tag SDS-PAGE to separate phosphorylated forms

    • Mass spectrometry to map specific phosphorylation sites

• Kinase Inhibitor Studies:

  • Treat cells with kinase inhibitors targeting relevant pathways

  • Monitor changes in Asr1 phosphorylation and function

  • Correlate with changes in gene silencing activities

• Cell Cycle Dependency:

  • Synchronize cells at different cell cycle stages

  • Use YOR314W antibodies to immunoprecipitate Asr1

  • Analyze phosphorylation status throughout the cell cycle

  • Correlate with cell cycle-dependent changes in gene silencing

This systematic approach allows researchers to understand how phosphorylation regulates Asr1 function and ensure that their antibody-based detection methods account for potential phosphorylation-dependent recognition issues.

What are the most common pitfalls in YOR314W antibody experiments and how can they be addressed?

Researchers working with YOR314W antibodies frequently encounter several challenges that can be systematically addressed through specific optimization strategies:

• Low Signal-to-Noise Ratio in Immunoblotting:

  • Problem: High background or weak specific signal

  • Solutions:

    • Optimize antibody concentration (typically 1:500-1:2000 dilution)

    • Increase blocking stringency (5% BSA or milk, 0.1-0.3% Tween-20)

    • Try alternative membranes (PVDF vs. nitrocellulose)

    • Consider using HRP-conjugated antibodies for direct detection

• Inconsistent Immunoprecipitation Efficiency:

  • Problem: Variable or low recovery of Asr1

  • Solutions:

    • Optimize lysis conditions (buffer composition, detergent concentration)

    • Increase antibody incubation time (up to overnight at 4°C)

    • Consider crosslinking for transient interactions

    • Use epitope-tagged Asr1 with commercial antibodies for consistent recognition

• Cross-Reactivity with Related Proteins:

  • Problem: Antibody recognizes proteins other than Asr1

  • Solutions:

    • Always include ∆asr1 deletion strains as negative controls

    • Perform immunodepletion experiments to confirm specificity

    • Consider using affinity-purified antibodies or monoclonal alternatives

    • Validate with orthogonal methods (mass spectrometry identification)

• Epitope Masking During Protein Interactions:

  • Problem: Reduced antibody recognition when Asr1 is in complexes

  • Solutions:

    • Use alternative antibodies recognizing different epitopes

    • Try mild denaturation before antibody incubation

    • Consider epitope-tagged versions with tags in different positions

    • Use proximity labeling approaches as an alternative

• Degradation During Sample Processing:

  • Problem: Protein degradation affecting results

  • Solutions:

    • Use comprehensive protease inhibitor cocktails with fresh PMSF

    • Process samples rapidly at cold temperatures

    • Consider adding deubiquitinase inhibitors (e.g., PR-619)

    • Optimize sample preparation for specific downstream applications

Implementing these solutions systematically can significantly improve experimental outcomes when working with YOR314W antibodies.

How can researchers optimize conditions for detecting Asr1-Ubp3 complexes using YOR314W antibodies?

Detection of Asr1-Ubp3 complexes requires careful optimization due to the potentially transient nature of this interaction and the complex regulatory mechanisms involved:

• Buffer Composition Optimization:

  • Test multiple lysis buffer compositions:

    • Standard yeast lysis buffer (0.1% Nonidet P-40, 10 mM phosphate buffer pH 8.0, 150 mM NaCl, 2 mM EDTA)

    • Lower stringency buffers (reduce detergent to 0.05%, reduce salt to 100 mM)

    • Add stabilizing agents (10% glycerol, 1 mM DTT)

  • Include comprehensive protease inhibitors as described in previous studies

  • Consider adding deubiquitinase inhibitors to preserve ubiquitylation status

• Crosslinking Approaches:

  • In vivo crosslinking: Treat cells with membrane-permeable crosslinkers:

    • DSP (dithiobis[succinimidyl propionate]) at 0.5-2 mM

    • Formaldehyde at 0.1-0.3%

  • In vitro crosslinking: Apply crosslinkers to lysates:

    • EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) for zero-length crosslinking

    • BS3 (bis(sulfosuccinimidyl)suberate) for longer spacer arms

• Sequential Immunoprecipitation Strategy:

  • First IP: Use α-FLAG or other tag antibodies for tagged Asr1

  • Elute under native conditions with FLAG peptide

  • Second IP: Use antibodies against Ubp3 or its tags

  • This approach significantly reduces background and confirms direct interaction

• Detection Method Optimization:

  • Try both standard and reverse immunoprecipitation approaches:

    • IP with YOR314W antibodies, detect Ubp3

    • IP with Ubp3 antibodies, detect Asr1

  • Use highly sensitive detection methods:

    • Enhanced chemiluminescence with extended exposure

    • Fluorescently labeled secondary antibodies with digital imaging

• Mutation Analysis for Interaction Mapping:

  • Test interaction with Ubp3 deletion constructs (∆N145, ∆N180) that have been shown to affect Asr1 interaction

  • Create scanning alanine mutants of Asr1 to map the Ubp3 interaction interface

  • This approach identifies critical residues for the interaction and provides controls for non-interacting mutants