YOR072W Antibody

What is YOR072W and what role does it play in cellular processes?

YOR072W is the systematic name for the gene encoding Asr1 (Alcohol Sensitive RING/PHD finger 1) in Saccharomyces cerevisiae. Asr1 functions as a ubiquitin ligase that associates with subtelomeric DNA and specifically ubiquitylates RNA polymerase II. This interaction prevents RNA polymerase II from transcribing certain genes, particularly those in subtelomeric regions . The protein contains both RING and PHD finger domains, which are crucial for its ubiquitin ligase activity and chromatin association, respectively. Understanding Asr1's role is essential for researchers studying transcriptional regulation, chromatin structure, and gene silencing mechanisms in yeast.

Which antibodies are recommended for detecting YOR072W/Asr1 protein?

For detecting YOR072W/Asr1, researchers typically use epitope-tagged versions of the protein coupled with commercial antibodies. Commonly used antibody-epitope combinations include:

• α-FLAG (M2-HRP, Sigma A8592) for FLAG-tagged Asr1

• α-MYC (9E10, available from various sources) for MYC-tagged Asr1

• α-HA (12CA5 or 3F10) for HA-tagged Asr1

When designing experiments, ensure your antibody selection matches your tagging strategy. For immunoprecipitation applications, antibody-conjugated beads like M2 affinity gel (Sigma A2220) provide excellent specificity and efficiency . Always validate antibody performance through Western blotting before proceeding to more complex applications like ChIP or co-immunoprecipitation.

How should I optimize antibody concentration for Western blot analysis of Asr1?

Optimizing antibody concentration for Asr1 Western blotting requires systematic titration:

• Start with a dilution range based on manufacturer recommendations (typically 1:500 to 1:5000)

• Prepare multiple identical blots from your samples

• Test each dilution on separate blots

• Assess signal-to-noise ratio at each concentration

• Select the dilution that provides clear specific signal with minimal background

For HRP-conjugated antibodies like α-FLAG M2-HRP, begin with 1:1000 to 1:2000 dilutions. For non-conjugated primary antibodies, start at 1:1000 followed by appropriate secondary antibodies (e.g., goat α-mouse IgG HRP at 1:5000) . Include both positive controls (known Asr1-expressing samples) and negative controls (deletion strains or untagged strains) to confirm specificity.

What protein extraction method is recommended for YOR072W/Asr1 detection?

For optimal YOR072W/Asr1 extraction, use a yeast lysis buffer containing:

• 0.1% Nonidet P-40

• 10 mM phosphate buffer, pH 8.0

• 150 mM NaCl

• 2 mM EDTA

• 50 mM NaF

• 0.1 mM Na₃VO₄

Supplement with freshly added protease inhibitors:

• 1 Complete tablet (Roche) per 50 mL

• 130 μL of 0.5 M benzamidine per 50 mL

• 500 μL of 0.1 M PMSF per 50 mL

Perform cell disruption via bead beating for thorough lysis of yeast cells. For rapid analysis of steady-state protein levels, alkali treatment lysis provides a quicker alternative, though it may be less suitable for applications requiring native protein conformations .

How can I establish the specificity of my YOR072W/Asr1 antibody?

Establishing antibody specificity for YOR072W/Asr1 requires multiple validation approaches:

• Genetic validation: Compare signal between wild-type and asr1Δ deletion strains

• Epitope competition: Pre-incubate antibody with purified epitope peptide to block specific binding

• Multiple antibody concordance: Verify similar patterns using different antibodies against distinct Asr1 epitopes

• Immunoprecipitation-mass spectrometry: Confirm pulled-down protein identity through MS analysis

• siRNA/CRISPR knockdown: Demonstrate reduced signal following targeted reduction of Asr1 expression

Document these validation experiments thoroughly as recommended by the antibody characterization guidelines . For publications, include images showing antibody specificity controls alongside experimental results to enhance reproducibility.

What protocol should I follow for chromatin immunoprecipitation (ChIP) to study Asr1 binding to subtelomeric regions?

For ChIP analysis of Asr1 binding to subtelomeric regions:

• Harvest logarithmic phase yeast cultures (OD₆₀₀ = 0.8-1.0)

• Crosslink protein-DNA complexes with 1% formaldehyde (10 minutes, room temperature)

• Quench with 125 mM glycine (5 minutes)

• Lyse cells and isolate chromatin

• Sonicate to generate 200-500 bp DNA fragments

• Immunoprecipitate with your validated Asr1 antibody (or epitope tag antibody if using tagged strains)

• Wash stringently to remove non-specific interactions

• Reverse crosslinks and purify DNA

• Quantify enrichment using qPCR with subtelomeric primers

For qPCR analysis, design primers for subtelomeric regions such as those used in published studies:

• 57W: GCCAAGCTTCCAATATCACGA and GGAATGATCTTGGAAATCGATCA

• 77C: GCGGCCCCAAATATTGTAT and TGGTGGTGATTTTGTGGGTA

• 74W: TGAAGGCGAACATGGCTTAT and TTTAGGAGAGGGAGCAGCAA

Always normalize to an intergenic region that doesn't bind Asr1 (e.g., VL region primer set: AATCTATCGGCAAGTATGGGGTAGC and TCATTTACGTGCAGAGTGCAAGAAC) .

How can I detect the ubiquitylation activity of Asr1 on RNA polymerase II?

To detect Asr1-mediated ubiquitylation of RNA polymerase II:

• Transform yeast with a plasmid expressing His-tagged ubiquitin (e.g., pUB221 with copper-inducible His-Ub)

• Grow cultures and induce His-Ub expression with CuSO₄

• Harvest cells and prepare lysates under denaturing conditions

• Perform nickel affinity purification to isolate His-ubiquitylated proteins

• Analyze by SDS-PAGE and immunoblotting with antibodies against:

  • RNA polymerase II (specifically phospho-CTD Ser-5, Millipore 04-1572)

  • Ubiquitin (to confirm purification success)

  • Asr1 (to detect potential self-ubiquitylation)

Compare wild-type Asr1 to RING-domain mutants as negative controls. Examine how various stress conditions affect ubiquitylation patterns. When troubleshooting, ensure denaturing conditions are stringent enough to disrupt non-covalent interactions while preserving the ubiquitin-target isopeptide bonds .

What approaches can I use to map the genome-wide binding profile of Asr1?

For genome-wide mapping of Asr1 binding:

• ChIP-seq approach:

  • Perform ChIP as described in question 2.2

  • Prepare sequencing libraries from immunoprecipitated DNA

  • Sequence using high-throughput platforms

  • Align reads to reference genome

  • Identify enriched regions using peak-calling algorithms

• DamID approach (alternative that avoids antibody usage):

  • Express Asr1-Dam methyltransferase fusion protein

  • Allow in vivo DNA methylation at binding sites

  • Extract genomic DNA

  • Digest with DpnI (cuts only at methylated GATC sites)

  • Amplify, sequence and map to genome

For DamID analysis, compare three strains:

• Wild-type Asr1-Dam fusion

• RING mutant Asr1-Dam fusion (functional binding domain but catalytically inactive)

• Unfused Dam under Asr1 promoter (control for accessibility bias)

Calculate enrichment ratios by determining the extent of DNA methylation at each site compared to the unfused Dam control.

How can I analyze interactions between Asr1 and RNA polymerase II using co-immunoprecipitation?

For co-immunoprecipitation of Asr1 and RNA polymerase II:

• Prepare yeast lysates in a buffer that preserves protein-protein interactions:

  • 0.1% Nonidet P-40

  • 10 mM phosphate buffer, pH 8.0

  • 150 mM NaCl

  • 2 mM EDTA

  • 50 mM NaF

  • 0.1 mM Na₃VO₄

  • Protease inhibitors as described earlier

• Conduct immunoprecipitation:

  • Incubate lysate with antibody against Asr1 (or its epitope tag) for 3 hours

  • Capture complexes on Protein G Sepharose

  • Wash extensively with lysis buffer

  • Elute by boiling in SDS-PAGE loading buffer

• Analyze by immunoblotting:

  • Probe for RNA polymerase II (using phospho-CTD Ser-5 antibody)

  • Probe for Asr1 to confirm successful immunoprecipitation

  • Include input samples for comparison

To validate specificity, perform reciprocal co-IP (immunoprecipitate RNA polymerase II and probe for Asr1). Test interactions under various conditions (e.g., different stresses, cell cycle stages) to identify regulatory mechanisms.

Why might I observe inconsistent results in ChIP experiments with YOR072W/Asr1 antibodies?

Inconsistent ChIP results with YOR072W/Asr1 antibodies can stem from several factors:

When working with Asr1, remember that its binding to subtelomeric regions may be influenced by chromatin state and transcriptional activity . Include biological replicates and appropriate controls (e.g., non-antibody samples, IgG controls) to assess experimental variability.

How should I interpret conflicting data between Western blot and immunofluorescence results for Asr1 localization?

When Western blot and immunofluorescence results for Asr1 localization conflict:

• Evaluate antibody specificity in each context:

  • Antibodies may recognize different epitopes or conformations

  • Some epitopes might be masked in certain cellular compartments

• Consider extraction conditions:

  • Western blot sample preparation may disrupt certain protein-protein interactions

  • Immunofluorescence fixation can sometimes create artifacts

• Assess protein fractionation:

  • Perform subcellular fractionation followed by Western blotting

  • Compare with immunofluorescence results to identify discrepancies

• Validate with orthogonal methods:

  • Express fluorescently-tagged Asr1 for live-cell imaging

  • Use proximity ligation assays to confirm protein interactions in situ

• Examine biological conditions:

  • Asr1's localization may change with stress, cell cycle, or nutrient status

  • Standardize conditions across experimental approaches

Conflicting results often reflect biological reality rather than technical errors. Asr1 likely shuttles between nuclear and cytoplasmic compartments depending on cellular conditions, with distinct pools performing different functions.

How can I apply antibody engineering techniques to develop improved YOR072W/Asr1 antibodies?

Modern antibody engineering approaches can significantly enhance YOR072W/Asr1 antibodies:

• Generative AI for de novo antibody design:

  • Leverage deep learning models trained on antibody-antigen interactions

  • Generate candidate sequences with optimal binding properties

  • Screen hundreds of thousands of variants using high-throughput methods

• Recombinant antibody fragment development:

  • Express single-chain variable fragments (scFvs) targeting specific Asr1 epitopes

  • Engineer smaller Fab fragments for improved tissue penetration

  • Create bispecific antibodies to simultaneously detect Asr1 and interacting partners

• Intrabody engineering:

  • Develop antibodies that function within living cells

  • Create variants that specifically recognize active vs. inactive Asr1 conformations

  • Engineer degradation-targeting antibodies to modulate Asr1 levels

When designing new antibodies, focus on regions unique to Asr1 rather than conserved RING/PHD domains to ensure specificity. Validate new antibodies thoroughly using the characterization guidelines outlined in question 2.1 .

What cutting-edge methods can be used to study Asr1 regulation of transcription dynamics?

To investigate Asr1's role in transcription dynamics:

• CUT&RUN or CUT&Tag:

  • These techniques offer higher resolution than conventional ChIP

  • They use targeted nucleases to cleave DNA where proteins of interest bind

  • Require less starting material and generate lower background

• Long-read native ChIP-seq:

  • Captures longer fragments to study promoter-enhancer interactions

  • Preserves native chromatin structure without crosslinking

  • Reveals how Asr1 influences three-dimensional chromatin organization

• Live-cell imaging of transcription:

  • MS2/PP7 systems to visualize nascent RNA production in real-time

  • Fluorescently-tagged RNA polymerase II to track elongation rates

  • Dual-color imaging to correlate Asr1 binding with transcriptional output

• Nascent RNA sequencing:

  • PRO-seq or NET-seq to measure active transcription genome-wide

  • Compare wild-type to asr1Δ strains to identify direct transcriptional targets

  • Analyze how Asr1-mediated ubiquitylation affects transcriptional pausing

These approaches can reveal how Asr1 influences not just whether genes are transcribed, but the kinetics and regulation of the transcription process itself.