YPL025C Antibody

Shipped with Ice Packs
In Stock

Description

Definition and Molecular Context

YPL025C refers to a chromosomal locus in yeast studied for its association with the Isw2 chromatin remodeling complex. The YPL025C antibody is used to investigate protein-DNA interactions at this locus, particularly focusing on the recruitment efficiency of Isw2p (a catalytic ATPase subunit) . This antibody has been critical in identifying chromatin architecture changes and gene repression mechanisms.

Applications in Research

The YPL025C antibody has been employed in:

  • Chromatin Immunoprecipitation (ChIP):
    Quantifying crosslinking efficiency of Isw2p at target loci, with YPL025C serving as a reference for normalization .

  • Gene Repression Studies:
    Analyzing the role of Isw2 complex subunits (e.g., Dls1p and Dpb4p) in establishing repressive chromatin structures at early meiotic genes like REC104 and POT1 .

  • PCR Validation:
    Primers specific to YPL025C (e.g., YPL025C (+) GACAGATACTTGAGCAGATTTTGTGG and YPL025C (−) CACAGTTTTAGTAGGGTCACCGATA) are used post-ChIP to amplify and quantify DNA-protein interactions .

Subunit Identification of the Isw2 Complex

Purification via FLAG immunoaffinity chromatography and mass spectrometry revealed two novel subunits:

SubunitMolecular WeightRole in Isw2 Complex
Dpb4p~24 kDaStabilizes chromatin interactions, homologous to CHRAC subunits
Dls1p (Yjl065cp)~18 kDaEssential for repressive chromatin at REC104 and POT1, partially redundant at other loci

Functional Insights

  • Dls1p is critical for Isw2-mediated repression of early meiotic genes but dispensable for Mat a-specific gene silencing .

  • Chromatin restructuring at Isw2 targets (e.g., STE6) depends on Dls1p, as shown by ChIP signal reductions in dls1Δ mutants .

Experimental Workflow

A typical ChIP assay using the YPL025C antibody involves:

  1. Crosslinking: Formaldehyde fixation of yeast cells.

  2. Chromatin Fragmentation: Sonication to shear DNA-protein complexes.

  3. Immunoprecipitation: YPL025C antibody enrichment of target chromatin regions.

  4. Quantitative PCR: Amplification using locus-specific primers (Table 1) .

Primer Sequences for YPL025C Quantification

Target LocusForward Primer (5’→3’)Reverse Primer (5’→3’)
YPL025CGACAGATACTTGAGCAGATTTTGTGGCACAGTTTTAGTAGGGTCACCGATA
STE6GCGACATAGCTGTTATTACCTACTAGGATGAACGGCAATAATGCAACAGT
POT1TGCTAGTTTTGAACCTATGCCACTATTCACTCTGTACTCAGAGCCAC

Technical Validation and Challenges

  • Specificity: The antibody’s efficacy is confirmed by comparing immunoprecipitation signals at YPL025C to positive controls (e.g., STE6) .

  • Limitations: Low molecular weight subunits like Dls1p and Dpb4p may evade detection in silver-stained gels, necessitating mass spectrometry for identification .

Broader Implications

Studies utilizing the YPL025C antibody have advanced understanding of chromatin remodeling in yeast, offering parallels to higher eukaryotes. For example, Dls1p’s homology to polɛ subunits suggests evolutionary conservation in chromatin regulation . Recent AI-driven antibody development efforts (e.g., LIBRA-seq) could further refine such reagents for high-throughput applications .

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M Phosphate Buffered Saline (PBS), pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
YPL025C antibody; LPB6 antibody; Putative uncharacterized protein YPL025C antibody
Target Names
YPL025C
Uniprot No.

Q&A

How should I validate a YPL025C antibody for experimental reproducibility?

Proper validation of YPL025C antibodies is essential for ensuring experimental reproducibility. Validation should include specificity testing through Western blotting against wild-type samples compared with YPL025C knockout controls. Additionally, researchers should report comprehensive antibody information including the supplier, catalog number, lot number, clonality (monoclonal or polyclonal), and host species . Batch-to-batch variability is a significant concern, particularly with polyclonal antibodies, making it crucial to document the specific batch used in your experiments . For YPL025C studies, validation should also include immunoprecipitation followed by mass spectrometry to confirm target binding specificity within yeast proteome contexts.

What critical information should be included when reporting YPL025C antibody use in methods sections?

When reporting YPL025C antibody use in research publications, include comprehensive details that enable experimental reproduction. Essential information includes:

  • Complete antibody identification (supplier, catalog number, RRID if available)

  • Antibody type (monoclonal/polyclonal, IgG subclass)

  • Species the antibody was raised in and target species compatibility

  • Batch/lot number to account for batch variability concerns

  • Detailed application parameters (dilution, incubation time and temperature)

  • The specific application method (Western blot, immunofluorescence, ChIP, etc.)

  • Antigen details (whether the antibody recognizes a specific domain or post-translational modification)

  • Validation methods performed

Clearly linking antibody information with experimental techniques within methods sections improves clarity and reproducibility .

How does antigen density affect YPL025C antibody binding in yeast cell applications?

Antigen density significantly impacts antibody binding effectiveness, particularly for bivalent binding modes of IgG antibodies. Research has demonstrated that at very low or very high antigen densities, antibody binding potency can be dramatically altered . For YPL025C applications in yeast cells, consider that the protein's expression level and cellular distribution will affect binding. At optimal densities, bivalent binding allows for increased avidity, while at low densities, binding may be predominantly monovalent, reducing effective affinity. When designing experiments with YPL025C antibodies, controlling for consistent expression levels of the target protein is crucial for obtaining reproducible results across experiments . The relationship between antigen density and binding is non-linear, with intermediate densities often providing optimal detection sensitivity.

How can I determine if my YPL025C antibody exhibits cross-reactivity with related proteins?

Cross-reactivity assessment is essential for accurate interpretation of YPL025C antibody results. Implement a multi-step validation approach:

  • Conduct sequence alignment analysis to identify proteins with similar epitope regions to YPL025C

  • Perform Western blot analysis using samples from:

    • Wild-type yeast cells

    • YPL025C deletion strains

    • Strains with overexpressed YPL025C protein

    • Strains with overexpressed related proteins

  • Use immunoprecipitation followed by mass spectrometry to identify all proteins captured by the antibody

  • Employ epitope mapping techniques to precisely define the antibody binding site

  • Test antibody specificity across different experimental conditions (denaturing vs. native)

Cross-reactivity testing is particularly important for YPL025C as it shares sequence homology with other yeast proteins. Document any observed cross-reactivity in your methods section to facilitate proper interpretation of results . When cross-reactivity is detected, additional validation steps such as using multiple antibodies targeting different epitopes can help confirm the specificity of observed signals.

What factors influence the molecular reach of antibodies and how does this affect YPL025C detection?

Molecular reach is the maximum antigen separation that supports bivalent binding and significantly impacts antibody function. Research has demonstrated that antibodies within the same isotype binding to the same antigen can display substantial differences in molecular reach (22-46 nm), exceeding their physical size (~15 nm) . For YPL025C detection, this parameter is critical because:

  • Antibodies with longer molecular reach show enhanced binding avidity through increased bivalent binding potential

  • Molecular reach variations between antibody clones can explain differences in detection sensitivity despite similar monovalent affinities

  • The spatial arrangement of YPL025C epitopes in cellular contexts may favor antibodies with specific reach characteristics

Studies have shown that molecular reach is one of the strongest correlates of functional potency, outperforming monovalent binding parameters such as affinity in predictive models . When selecting antibodies for YPL025C detection in complex cellular environments, those with optimized reach characteristics may provide superior sensitivity and specificity.

How can I computationally design improved YPL025C antibodies with enhanced specificity?

Computational antibody design represents an advanced approach to generating highly specific YPL025C antibodies. The process involves:

  • Identifying template antibodies with structural and sequence homology to the desired epitope region

  • Employing computational platforms such as RosettaAntibodyDesign (RAbD) to model structural interactions and generate design variants

  • Calculating predicted binding energies for candidate designs and prioritizing those with favorable interaction profiles

  • Manual inspection of models to evaluate potential improvements in hydrogen bonding, hydrophobic packing, and contact surface area

  • Experimental validation through expression, purification, and affinity measurement assays

When designing YPL025C antibodies, focus on complementarity-determining regions (CDRs) modifications that enhance target specificity. The design process should include evaluation of both interface energy and total energy scores for individual mutations . Successful computational design has been demonstrated for coronavirus spike proteins, where antibodies were redesigned to switch specificity from SARS-CoV-1 to SARS-CoV-2 with nanomolar binding affinity . Similar approaches could yield YPL025C antibodies with dramatically improved specificity and affinity profiles.

How should I address batch-to-batch variability when using YPL025C antibodies in longitudinal studies?

Batch-to-batch variability presents a significant challenge for longitudinal YPL025C studies. Implement these strategies to mitigate variability effects:

  • Purchase sufficient antibody from a single batch for the entire study duration when possible

  • Always document batch/lot numbers in laboratory records and publications

  • Perform side-by-side validation when transitioning between batches:

    • Compare titration curves for both batches

    • Assess signal-to-noise ratios across identical samples

    • Quantify binding affinity parameters for critical benchmarking

  • Maintain internal reference standards and control samples for normalization

  • Consider creating standardized calibration curves for quantitative applications

For polyclonal antibodies, which show greater batch variability than monoclonals, implement more stringent validation protocols when changing batches . When significant batch differences are observed, you may need to adjust experimental parameters such as antibody concentration or incubation times to maintain consistent results.

What are the optimal parameters for measuring YPL025C antibody binding kinetics?

Accurate measurement of YPL025C antibody binding kinetics requires careful experimental design. Biolayer Interferometry (BLI) or Surface Plasmon Resonance (SPR) are recommended methods with these optimization considerations:

  • Sample preparation:

    • Ensure antibody purity through affinity chromatography and size exclusion

    • Validate target protein folding through circular dichroism or thermal shift assays

    • Use freshly prepared reagents to avoid degradation effects

  • Experimental parameters:

    • Test multiple antibody concentrations (typically 0.1-100× the expected KD)

    • Include sufficient association and dissociation phases (15-30 minutes each)

    • Implement reference subtraction to account for non-specific binding

    • Maintain constant buffer conditions and temperature

  • Data analysis:

    • Fit data to appropriate binding models (1:1, bivalent)

    • Extract key parameters: kon (association rate), koff (dissociation rate), and KD (equilibrium constant)

    • Validate consistency across replicates

For YPL025C antibodies, measuring both monovalent (Fab fragment) and bivalent (intact IgG) binding provides crucial insights into avidity effects. Research has demonstrated that bivalent binding parameters, particularly molecular reach, can be more predictive of functional efficacy than simple affinity measurements .

How can I distinguish between monovalent and bivalent binding of YPL025C antibodies?

Distinguishing between monovalent and bivalent binding modes is critical for understanding YPL025C antibody function. Implement these methodological approaches:

  • Compare intact IgG with Fab fragments:

    • Generate Fab fragments through enzymatic digestion (papain or pepsin)

    • Measure binding kinetics of both formats under identical conditions

    • Bivalent binding typically exhibits significantly slower dissociation rates

  • Perform surface density titration experiments:

    • Immobilize YPL025C protein at different densities

    • Measure antibody binding at each density

    • Plot binding parameters against antigen density

    • Bivalent binding shows strong dependency on antigen spacing

  • Apply mathematical modeling:

    • Implement particle-based bivalent models that incorporate molecular reach

    • Compare fits between monovalent (ODE-based) and bivalent models

    • Quantify the bivalent enhancement factor

Research has demonstrated that approximately 39% of antibodies show significant bivalent binding characteristics that cannot be accurately modeled with simple monovalent binding equations . For YPL025C antibodies, understanding the contribution of bivalent binding is essential for accurate interpretation of binding data, particularly when comparing different antibody clones or formats.

How do various epitope locations on YPL025C affect antibody functionality?

The epitope location on YPL025C significantly impacts antibody functionality beyond simple binding affinity. Research examining antibody-antigen interactions has demonstrated that:

  • Epitope location relative to functional domains affects blocking capability:

    • Antibodies targeting catalytic or protein-protein interaction sites show enhanced functional inhibition

    • The distance from critical functional regions inversely correlates with blocking potential

  • Epitope accessibility varies in different cellular contexts:

    • Surface-exposed regions provide consistent accessibility

    • Regions involved in complex formation may show context-dependent accessibility

    • Post-translational modifications can mask or create epitopes

  • Epitope location influences binding parameters:

    • Some epitope regions permit extended molecular reach (up to 46 nm)

    • Certain locations facilitate more efficient bivalent binding

For YPL025C antibodies, epitope mapping through techniques such as hydrogen-deuterium exchange mass spectrometry or alanine scanning mutagenesis provides crucial information for predicting functionality. Interestingly, research has shown that molecular reach and epitope location independently contribute to antibody functionality, suggesting that both parameters should be optimized for maximum effectiveness .

What approaches can improve reproducibility when using YPL025C antibodies in multi-laboratory studies?

Multi-laboratory studies using YPL025C antibodies require stringent standardization protocols to ensure reproducibility. Implement these advanced approaches:

  • Centralized antibody validation and distribution:

    • Validate antibody performance using standardized protocols

    • Distribute identical antibody aliquots from the same batch

    • Provide detailed validation documentation including positive and negative controls

  • Standardized experimental protocols:

    • Develop detailed standard operating procedures (SOPs)

    • Include specific parameters for each experimental technique

    • Conduct preliminary cross-laboratory validation studies

  • Reference standards:

    • Establish common positive and negative control samples

    • Create calibration standards for quantitative applications

    • Implement normalization procedures for inter-laboratory comparison

  • Comprehensive reporting:

    • Document all relevant antibody information in publications

    • Include batch numbers, validation data, and detailed methods

    • Consider pre-registering experimental protocols

  • Data sharing:

    • Implement standardized data formats

    • Share raw data along with processed results

    • Document analysis pipelines in detail

Research has shown that inconsistent antibody reporting and validation are major contributors to reproducibility challenges . Implementing these approaches can significantly improve consistency across laboratories and enhance the reliability of YPL025C research findings.

How can emergent binding properties of YPL025C antibodies be predicted from molecular parameters?

Predicting emergent binding properties of YPL025C antibodies requires integration of multiple molecular parameters. Advanced modeling approaches incorporate:

  • Comprehensive binding parameters:

    • Monovalent parameters: kon, koff, KD

    • Bivalent parameters: bivalent on-rate, molecular reach

    • Epitope characteristics: location, accessibility

  • Particle-based simulation models:

    • Simulate antibody-antigen interactions on two-dimensional surfaces

    • Incorporate varying antigen densities

    • Calculate the antibody concentration required for 50% antigen binding

  • Multiple linear regression models:

    • Combine binding parameters with epitope characteristics

    • Identify parameters with highest predictive value

    • Generate quantitative predictions of binding potency

Research has demonstrated that the molecular reach of antibodies is often the single best predictor of functional potency, outperforming traditional affinity measurements . For YPL025C antibodies, simulation-based approaches can predict binding under different experimental conditions without requiring extensive empirical testing.

ParameterCorrelation with Binding PotencyRelative Importance
Molecular ReachHigh (r² > 0.5)+++
Monovalent AffinityModerate (r² ~ 0.3)++
Epitope LocationModerate (r² ~ 0.3)++
Bivalent On-rateLow (r² < 0.1)+
Multiple Parameters CombinedVery High (r² > 0.7)++++

This integrated approach enables rational selection of YPL025C antibodies based on predicted performance rather than empirical testing alone .

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.