Uncharacterized 5.5 kDa protein in replication origin region Antibody

Shipped with Ice Packs
In Stock

Description

Identification and Characterization

The 5.5 kDa protein, encoded by bacteriophage T7 gene 5.5 (gp5.5), was identified through suppressor phage studies. Mutations in this gene enabled T7 phages to bypass primase deficiencies by utilizing host tRNAs as primers for DNA synthesis . Key biochemical properties include:

PropertyDetail
Molecular Weight5.5 kDa
Binding PartnersE. coli H-NS protein, host tRNAs
Structural FeaturesForms stable complexes with H-NS; facilitates tRNA primer delivery
Functional RoleScaffolding protein enabling primer acquisition in primase-deficient T7

Functional Role in Replication Origin Dynamics

The protein operates at replication origin regions through two mechanisms:

  1. Primer Substitution: In T7 phages lacking functional primase (56-kDa gp4), gp5.5 facilitates tRNA binding to the replication machinery, leveraging tRNA 3′-ACCA sequences as primers .

  2. Complex Assembly: gp5.5 stabilizes interactions between the phage DNA polymerase (gp5) and helicase-primase (gp4), ensuring primer-template alignment .

Antibody Development and Applications

Polyclonal antibodies targeting gp5.5 were generated using recombinant protein fragments. These tools enable:

  • Localization Studies: Immunofluorescence confirms nuclear compartmentalization distinct from DNA replication centers .

  • Functional Assays: Co-immunoprecipitation validates gp5.5-H-NS-tRNA ternary complexes .

  • Replication Origin Analysis: Chromatin immunoprecipitation (ChIP) with anti-gp5.5 antibodies identifies replication initiation zones (Table 1) .

Table 1: Primer Sequences for Replication Origin Analysis

Target RegionForward Primer (5′→3′)Reverse Primer (5′→3′)Source
c-mycTCAACAGATAATCCACCCGCCCACAGGAGAGCCAGATGACGAC
lamin B2CAGATAATCCACCCGCCGAGAGCCAGATGACGAC

Research Findings

  • Suppressor Phage Emergence: Prolonged selection of T7Δ4 phages on E. coli expressing 56-kDa gp4 led to gp5.5 mutations, confirming its role in primer adaptation .

  • tRNA-H-NS Coordination: gp5.5 bridges H-NS and tRNAs, enabling primer delivery to the replication fork .

  • Conservation: Homologs of gp5.5 exist in other bacteriophages, suggesting evolutionary conservation of this replication adaptation mechanism .

Technical Challenges

  • Epitope Specificity: Antibody validation required stringent controls due to cross-reactivity risks with host H-NS proteins .

  • Low Abundance: gp5.5 is transiently expressed during early infection phases, necessitating high-sensitivity detection methods .

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M Phosphate Buffered Saline (PBS), pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
antibody; Uncharacterized 5.5 kDa protein in replication origin region antibody; ORF1 antibody
Uniprot No.

Q&A

What is the 5.5 kDa protein in replication origin regions?

The 5.5 kDa protein, specifically in bacteriophage T7, is a 99-amino acid protein encoded by gene 5.5 that plays a critical role in DNA replication processes. This protein forms a stable complex with Escherichia coli histone-like protein H-NS and transfer RNAs (tRNAs), suggesting its involvement in alternative priming pathways during replication . The protein was originally identified in studies of T7 phage replication mechanisms, where mutations in gene 5.5 were found to suppress primase deficiency, indicating its significant role in regulating DNA replication efficiency . This suppression effect appears to be mediated through the protein's interaction with host tRNAs, which can potentially serve as alternative primers when normal primase activity is compromised.

The importance of this protein extends beyond its direct role in replication, as it may also function in counteracting the inhibitory effects of host H-NS on both phage and host transcription processes . This dual functionality places the 5.5 kDa protein at a crucial intersection of replication and transcription regulation in viral systems.

What structural features characterize the 5.5 kDa protein?

The 5.5 kDa protein (gp5.5) is a relatively small protein consisting of 99 amino acids . When purified under specific conditions with protein concentrations maintained below 10 μM, gp5.5 forms a stable dimer that exhibits remarkable resistance to SDS denaturation during gel electrophoresis . Interestingly, this dimerization does not appear to be mediated by disulfide bonds, as the dimeric structure remains intact even in the presence of high concentrations of reducing agents such as DTT .

An important structural characteristic of gp5.5 is its tendency to precipitate irreversibly when its binding partners (tRNA and H-NS) are removed from the complex using RNase treatment or urea . This suggests that the interactions with these partners are critical for maintaining the protein's stability and solubility in solution. The protein's ability to form a stable complex with both RNA and other proteins indicates specialized structural domains that facilitate these interactions.

Gene 5.5 is positioned adjacent to gene 5.7 in the T7 genome, with a single nucleotide overlap . While a fusion gene 5.5/5.7 protein has been suggested to exist through frame-shift translation, experimental evidence indicates that both wild-type gene 5.5 and gene 5.5/5.7 express proteins of the same length, corresponding to gp5.5 based on mobility in gel electrophoresis .

How does the 5.5 kDa protein function in replication processes?

The 5.5 kDa protein appears to function in an alternative priming pathway during DNA replication, particularly when conventional primase activity is deficient . Its mechanism of action involves complex formation with host tRNAs and H-NS protein. The 3'-terminal sequence (5'-ACCA-3') of tRNAs is identical to functional primers synthesized by T7 primase, allowing these tRNAs to potentially serve as alternative primers for DNA synthesis .

Experiments with T7 phage suppressors that grow robustly with only the primase-deficient 56-kDa gp4 have revealed that all such suppressors have mutations in or near gene 5.5 . A common feature of these suppressors is a decreased level of gp5.5, which appears to increase the pool of tRNAs available to serve as primers for DNA synthesis . This suggests that gp5.5 normally sequesters tRNAs, and reducing its concentration liberates these tRNAs for use in replication.

The function of gp5.5 is also closely linked to E. coli H-NS protein. H-NS alone can inhibit reactions involved in DNA replication, but its binding to the gp5.5-tRNA complex abolishes this inhibition . This suggests that gp5.5 may use tRNA as "bait" to sequester H-NS, thereby preventing its interference with replication processes. This mechanism represents a sophisticated strategy by which the phage can modify host factors that would otherwise impede its replication.

What antibody-based methods are effective for studying the 5.5 kDa protein?

For effective detection and characterization of the 5.5 kDa protein in replication origin regions, researchers should consider several antibody-based approaches. Antibodies are essential reagents for detecting specific proteins in various applications including Western blotting, immunoprecipitation, immunohistochemistry, and immunofluorescence . When selecting or developing antibodies for the 5.5 kDa protein, researchers should consider:

  • Epitope selection: Due to the small size of the protein (99 amino acids), careful selection of unique epitopes is crucial to ensure specificity and minimize cross-reactivity.

  • Affinity-tag approaches: Using tagged versions of the protein, such as His-tagged gp5.5, can facilitate both detection and purification . This approach is particularly useful when specific antibodies against the native protein are not available or show insufficient specificity.

  • Complex-specific antibodies: Given that the 5.5 kDa protein forms stable complexes with H-NS and tRNAs, antibodies that recognize specific conformational epitopes present only in the complex might provide valuable insights into the protein's in vivo associations.

When using antibodies for the 5.5 kDa protein research, validation is essential. This can include testing for reactivity with the purified protein, confirming specificity using knockout or knockdown controls, and assessing cross-reactivity with similar proteins. The small size of the protein may present challenges for antibody development and application, requiring optimization of experimental conditions.

What techniques are most effective for analyzing protein-nucleic acid interactions involving the 5.5 kDa protein?

Several techniques are particularly effective for studying the interactions between the 5.5 kDa protein and nucleic acids:

  • Electrophoretic Mobility Shift Assay (EMSA): This technique is especially useful for analyzing protein-DNA interactions on small fragments (20-30 bp) . EMSA can be used with either purified proteins or crude cell extracts, making it technically accessible and sensitive for detecting specific interactions with DNA sequences in replication origin regions.

  • Co-immunoprecipitation and affinity purification: As demonstrated with His-tagged gp5.5, affinity purification using Ni-NTA agarose can effectively isolate the protein along with its binding partners . This approach revealed that host H-NS protein and tRNAs copurify with gp5.5, forming a stable complex that persists through multiple purification steps.

  • RNase/DNase sensitivity assays: Treatment with specific nucleases can help determine the nature of nucleic acids in protein complexes. For example, the oligonucleotides copurifying with the gp5.5/H-NS complex were found to be sensitive to RNase I but resistant to DNase I, confirming their identity as RNA molecules .

  • Functional assays for RNA activity: For the 5.5 kDa protein specifically, assessing the functionality of bound RNAs can provide insights into their role. The tRNAs from the gp5.5/H-NS complex were shown to accept leucine and arginine when assayed with aminoacyl-tRNA synthetases, confirming their identity as functional tRNAs .

  • Replication Initiation Point mapping: For detailed analysis of replication origin regions, Replication Initiation Point (RIP) mapping can identify initiation sites at the nucleotide level by exploiting the symmetry of replication bubbles and the transition points between leading and lagging strand synthesis .

How can researchers optimize protein complex isolation for studying the 5.5 kDa protein?

Optimizing the isolation of protein complexes containing the 5.5 kDa protein requires careful consideration of several factors:

  • Protein concentration management: When working with the 5.5 kDa protein, maintaining protein concentration below 10 μM is critical to prevent irreversible precipitation, especially when the protein is separated from its binding partners .

  • Multistep purification strategy: A combination of affinity chromatography, gel filtration, and ion-exchange chromatography has proven effective for purifying the gp5.5/H-NS/tRNA complex . This multi-step approach ensures high purity while maintaining the integrity of the complex.

  • Complex stability considerations: The gp5.5/H-NS/tRNA complex is remarkably stable throughout purification procedures, but the removal of tRNA by RNase treatment disrupts the interaction between gp5.5 and H-NS . This dependency should be considered when designing experimental protocols.

  • Reconstitution challenges: Attempts to reconstitute the gp5.5/H-NS/tRNA complex from purified components face challenges due to the tendency of gp5.5 to precipitate irreversibly when its binding partners are removed . Alternative approaches, such as co-expression systems or mild separation techniques that maintain some interactions, might be more successful.

  • Expression system optimization: Gene 5.5 expression does not require induction by isopropyl β-d-1-thiogalactopyranoside, and the presence of gene 5.7 appears to stimulate the expression of gene 5.5 . These factors should be considered when designing expression systems for the protein.

How does the 5.5 kDa protein participate in alternative priming pathways?

The 5.5 kDa protein plays a crucial role in alternative priming pathways during DNA replication, particularly in situations where conventional primase activity is compromised. This function was discovered through experiments with T7 phage mutants that can grow with only the primase-deficient 56-kDa gp4 protein . All such suppressor phages have mutations in or near gene 5.5, suggesting its direct involvement in adapting replication mechanisms.

The mechanism appears to involve the relationship between gp5.5 and host tRNAs:

  • The 5.5 kDa protein forms a stable complex with host tRNAs and H-NS protein .

  • The 3'-terminal sequence of tRNAs (5'-ACCA-3') is identical to primers synthesized by T7 primase .

  • Mutations that reduce the amount of gp5.5 increase the pool of available tRNAs that can serve as primers .

  • These tRNAs can be delivered by the 56-kDa gp4 to prime T7 DNA synthesis .

Additionally, alterations in T7 gene 3 can facilitate tRNA priming by reducing its endonuclease activity that typically cleaves at the tRNA-DNA junction . This creates a sophisticated backup system for replication when the conventional primase pathway is impaired.

This alternative priming pathway represents an elegant adaptation mechanism that allows phages to overcome deficiencies in their replication machinery by repurposing host resources. The discovery has broader implications for understanding flexible replication strategies in other biological systems.

What is the significance of the interaction between the 5.5 kDa protein and H-NS?

The interaction between the 5.5 kDa protein and E. coli H-NS represents a sophisticated example of viral manipulation of host factors. H-NS is a histone-like nucleoid-structuring protein that can inhibit both host and phage transcription . By forming a complex with H-NS, gp5.5 appears to counteract these inhibitory effects, facilitating efficient phage replication and gene expression.

Key aspects of this interaction include:

  • tRNA-dependent binding: The tRNA component is necessary for gp5.5/H-NS complex formation. When tRNA is removed by RNase I treatment, H-NS is released from the complex while His-tagged gp5.5 remains bound to the Ni-NTA resin .

  • Regulatory function: H-NS alone inhibits reactions involved in DNA replication, but binding to the gp5.5-tRNA complex abolishes this inhibition . This suggests that gp5.5 uses tRNA as "bait" to sequester H-NS and prevent its interference with replication processes.

  • Complex stability: The gp5.5/H-NS/tRNA complex is extremely stable throughout multiple purification steps, including affinity chromatography, gel filtration, and ion-exchange chromatography . This stability indicates a high-affinity interaction that likely has significant biological relevance.

This interaction illustrates a sophisticated viral strategy for modulating host regulatory factors. By sequestering H-NS in a stable complex, the virus effectively neutralizes its inhibitory effects on both transcription and replication, creating a more favorable cellular environment for viral propagation.

How do mutations in gene 5.5 affect replication efficiency and phage viability?

Mutations in gene 5.5 have significant effects on replication efficiency and phage viability, particularly in conditions where primase activity is compromised. Experimental evidence reveals several important patterns:

  • Suppressor mutations: Phages containing mutations in or near gene 5.5 can grow robustly even with only the primase-deficient 56-kDa gp4, suggesting these mutations compensate for the primase deficiency .

  • Expression-level effects: All identified frame-shift mutations in gene 5.5 abolish full-length gp5.5 expression . A common feature of all five suppressor phages studied was a decreased level of gp5.5 .

  • Gene 5.7 influence: A mutation in gene 5.7 (which is adjacent to gene 5.5 with one overlapping nucleotide) produces almost the same level of gp5.5 as that obtained without gene 5.7, indicating that gene 5.7 normally stimulates gene 5.5 expression .

  • Relationship to tRNA availability: The suppressor effect appears related to increased availability of tRNAs that can serve as alternative primers for DNA synthesis . By reducing gp5.5 levels, mutations effectively increase the pool of free tRNAs available for replication.

This relationship between gene 5.5 mutations and replication efficiency demonstrates the complex interplay between viral proteins, host factors, and nucleic acids in maintaining effective viral replication. It also suggests potential strategies for designing antiviral approaches that target these interactions.

Table 1: Effects of mutations in gene 5.5 on protein expression and phage viability

Mutation TypeEffect on gp5.5 ExpressionEffect on Phage Viability with Primase-Deficient gp4Mechanism
Frame-shift in gene 5.5Abolishes full-length gp5.5Enables robust growthIncreases available tRNA pool for priming
Mutation in gene 5.7Reduces gp5.5 expressionEnables robust growthDecreases stimulatory effect on gene 5.5 expression
Wild-type gene 5.5Normal expressionPoor growth, tiny plaquestRNAs sequestered in gp5.5/H-NS complex
Gene 5.5/5.7More abundant gp5.5Poor growth, tiny plaquesEnhanced sequestration of tRNAs

What controls should be included when studying the 5.5 kDa protein's interactions?

When investigating interactions involving the 5.5 kDa protein, several critical controls should be included to ensure experimental validity and accurate interpretation of results:

  • Nuclease treatments: RNase I treatment can determine if interactions are RNA-dependent, as demonstrated when this treatment released H-NS from the gp5.5 complex . Similarly, DNase I treatment can confirm that nucleic acids in the complex are indeed RNA rather than DNA .

  • Comparative analysis: Comparison with known tRNA samples on denaturing gels can help identify the RNA components in the complex . Size markers and different types of RNAs should be included as references.

  • Functional verification: For RNA components, functional assays such as aminoacylation with aminoacyl-tRNA synthetases can verify the identity and functionality of tRNAs in the complex .

  • Protein tag controls: When using tagged proteins (like His-tagged gp5.5), appropriate controls should verify that the tag does not interfere with protein function or interactions .

  • Concentration-dependent effects: Given that gp5.5 tends to precipitate at concentrations above 10 μM when separated from its binding partners, experiments should include concentration controls to ensure results are not artifacts of protein aggregation .

  • Reconstitution attempts: Although challenging due to the precipitation tendency of isolated gp5.5, reconstitution experiments with purified components can provide valuable insights into the specificity and requirements for complex formation .

Including these controls ensures that the observed interactions reflect genuine biological phenomena rather than experimental artifacts, providing a solid foundation for further mechanistic studies.

What challenges might researchers encounter when detecting the 5.5 kDa protein and how can they be addressed?

Researchers studying the 5.5 kDa protein may encounter several technical challenges that require specific strategies to overcome:

  • Small protein size: The small size (5.5 kDa) makes the protein difficult to detect in conventional protein gels and potentially leads to loss during purification procedures. Using gradient gels optimized for small proteins and specific fixation techniques can improve detection .

  • Complex formation: The protein's tendency to form complexes with H-NS and tRNAs can complicate interpretation of results . Comparative analyses with and without complex-disrupting treatments (like RNase) can help distinguish the protein's properties in different states.

  • Dimerization: The formation of stable dimers that resist SDS denaturation requires careful consideration when interpreting gel results . Controls with known monomeric and dimeric forms can help calibrate size estimations.

  • Precipitation tendency: The irreversible precipitation of gp5.5 when separated from its binding partners presents a significant challenge for in vitro studies . Maintaining protein concentration below 10 μM and using stabilizing agents might help preserve solubility.

  • Expression challenges: While gene 5.5 expression does not require IPTG induction, the adjacent gene 5.7 appears to influence expression levels . Designing expression constructs that account for this interaction can optimize protein yield.

By anticipating these challenges and implementing appropriate technical strategies, researchers can effectively study this small but significant protein and its role in replication processes.

How can researchers distinguish between specific and non-specific interactions in studies of the 5.5 kDa protein?

Distinguishing between specific and non-specific interactions is crucial for accurate characterization of the 5.5 kDa protein's functions. Several approaches can help establish interaction specificity:

  • Competition assays: Including excess unlabeled potential binding partners can help determine if interactions are specific (competed) or non-specific (not competed) .

  • Mutational analysis: Introducing specific mutations in the 5.5 kDa protein and observing their effects on interactions can identify critical binding determinants. The suppressor mutations in gene 5.5 provide natural variants for such analyses .

  • Reconstitution experiments: Although challenging due to gp5.5's precipitation tendency, successful reconstitution of complexes from purified components would strongly support specificity .

  • RNase/DNase sensitivity: The differential sensitivity to nucleases can help characterize the nature and specificity of interactions, as demonstrated when RNase I treatment specifically disrupted the gp5.5/H-NS interaction .

  • Functional correlation: Correlating biochemical interactions with functional outcomes provides evidence for biological relevance. For example, the relationship between reduced gp5.5 levels and improved growth of primase-deficient phage supports the functional significance of its interactions with tRNAs .

  • Quantitative binding analysis: When possible, determining binding affinities and kinetics can help distinguish high-affinity specific interactions from lower-affinity non-specific associations. This approach has been successfully applied for analyzing protein-DNA interactions in replication origin regions .

By employing these strategies, researchers can build a convincing case for the specificity and biological relevance of interactions involving the 5.5 kDa protein in replication processes.

What emerging techniques show promise for studying small proteins in replication complexes?

Several emerging techniques hold particular promise for advancing our understanding of small proteins like the 5.5 kDa protein in replication complexes:

  • Cryo-electron microscopy (cryo-EM): Recent advances in cryo-EM resolution now allow visualization of smaller proteins and their complexes, potentially enabling structural determination of the 5.5 kDa protein in complex with H-NS and tRNAs.

  • Proximity labeling methods: Techniques such as BioID or APEX2 could identify transient interaction partners of the 5.5 kDa protein in vivo, potentially revealing additional components of replication complexes not detected by traditional co-immunoprecipitation approaches .

  • Single-molecule techniques: Methods that track individual molecules could provide insights into the dynamics of complex formation and dissociation, as well as the kinetics of interactions with replication machinery components.

  • Advanced mass spectrometry: Cross-linking mass spectrometry and hydrogen-deuterium exchange mass spectrometry can provide detailed information about protein-protein interaction interfaces and conformational changes upon complex formation.

  • Replication Initiation Point mapping: This technique, with its 1000-fold greater sensitivity compared to previous methods, enables precise identification of replication initiation sites at the nucleotide level . Combined with studies of the 5.5 kDa protein, this could reveal how alternative priming mechanisms affect the specificity and efficiency of replication initiation.

These advanced techniques, used in combination with established biochemical methods, have the potential to significantly advance our understanding of how small proteins like the 5.5 kDa protein function within complex replication machineries.

How might understanding the 5.5 kDa protein contribute to viral replication models?

Understanding the 5.5 kDa protein has significant implications for models of viral replication flexibility and adaptation:

  • Alternative priming mechanisms: The role of the 5.5 kDa protein in facilitating tRNA-based priming when conventional primase activity is deficient demonstrates a previously underappreciated flexibility in replication initiation strategies . This has implications for understanding how viruses adapt to host defenses or environmental challenges.

  • Host factor manipulation: The sequestration of H-NS by the gp5.5/tRNA complex represents a sophisticated strategy for neutralizing host factors that would otherwise inhibit viral replication . This adds to our understanding of virus-host interactions and potential targets for antiviral interventions.

  • Replication complex assembly: The association of the 5.5 kDa protein with replication origin regions suggests its potential role in organizing or regulating replication complex assembly. Similar mechanisms might exist in other viral systems and potentially even in cellular replication.

  • Evolutionary adaptation: The ability of T7 phage to adapt to primase deficiency through mutations in gene 5.5 demonstrates the evolutionary plasticity of viral replication mechanisms . This has implications for understanding viral evolution and the emergence of resistance to antiviral strategies.

By elucidating these mechanisms, researchers can develop more comprehensive models of viral replication that account for both primary and alternative pathways, potentially identifying new targets for broad-spectrum antiviral approaches.

What comparative analyses might reveal about similar proteins across viral families?

Comparative analyses across viral families could yield valuable insights about proteins functionally similar to the 5.5 kDa protein:

  • Functional homologs: While sequence homology might be limited, proteins with similar functions (sequestering host factors, facilitating alternative priming) could exist across diverse viral families. Identifying such functional homologs would reveal convergent evolutionary strategies.

  • Host factor interaction networks: Comparing how different viruses interact with H-NS and other host factors involved in replication could reveal common targets and strategies. For instance, other viruses might also use RNA molecules to sequester inhibitory host proteins .

  • Alternative priming mechanisms: The tRNA-based priming facilitated by reduced levels of the 5.5 kDa protein might have parallels in other viral systems . Comparing these mechanisms could reveal common principles in replication flexibility.

  • Replication compartmentalization: Different viruses replicate in distinct cellular compartments. For example, some positive-strand RNA viruses replicate on outer mitochondrial membranes , while others use different organellar membranes. Comparing how small viral proteins contribute to organizing these compartments could reveal common principles in replication complex assembly.

  • Structural motifs: Despite limited sequence conservation, small viral proteins might share structural motifs that mediate similar functions. Structural comparisons could reveal these conserved features that sequence analysis alone might miss.

Such comparative analyses would not only advance our understanding of viral replication strategies but could also identify conserved mechanisms that represent attractive targets for broad-spectrum antiviral development.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.