Antibodies targeting epitope tags fused to YSC84 enable precise tracking of its expression and localization. Common tagging approaches include:
Key Insight: The SH3 domain of Ysc84 is critical for its recruitment to endocytic sites, while actin/lipid-binding domains are dispensable for localization but essential for function .
Ysc84 mutants (e.g., KK, RR, LK) were analyzed using GFP-tagged constructs and anti-GFP antibodies:
Actin-binding mutants (KK/RR): Retained endocytic localization but caused depolarized actin patches and temperature-sensitive growth defects .
Lipid-binding mutant (LK): Partially restored actin organization, highlighting lipid interactions' role in membrane invagination .
SH3 deletion mutant: Failed to localize to endocytic sites, confirming SH3-mediated recruitment .
The human YSC84 homolog SH3yl-1 was expressed in yeast using a methionine-regulated promoter. Anti-SH3yl-1 antibodies (or anti-tag antibodies) revealed:
Partial rescue of temperature sensitivity in Δysc84 Δlsb5 mutants .
Dominant-negative actin depolarization when overexpressed, indicating conserved actin-binding functionality .
Western Blotting: Anti-GFP antibodies confirmed Ysc84-GFP expression levels in mutants (e.g., RL73,74AA showed instability) .
Two-Hybrid Screens: Anti-myc/HA antibodies identified Ysc84 interactions with Sla1p and Las17, critical for endocytic complex formation .
Kymograph Analysis: Antibody-validated reporters (e.g., Sla1-GFP) demonstrated delayed invagination rates upon YSC84 overexpression .
Table 2: Oligonucleotides for YSC84 Tagging
(From )
| Oligo | Sequence (5’→3’) | Purpose |
|---|---|---|
| oKA165 | ACTTCACAGTAAAATTTTCAAGAGTAGTGGTAATATCAAAT | N-terminal Ysc84 tagging |
| oKA216 | GGACTAACGGAAAAGAAGGAATATTCCCTGCAAACTACGTT | C-terminal Ysc84 tagging + linker |
Overexpression Effects: Elevated Ysc84 levels delayed invagination (Sla1-GFP lifetime increased by 38%) and displaced later-stage proteins like Rvs167-GFP .
Genetic Interaction with Lsb5: Δysc84 Δlsb5 double mutants showed synthetic lethality, emphasizing their synergistic role in actin organization .
Regulatory Mechanism: Ysc84 actin binding is inhibited by PI(4,5)P₂, linking lipid signaling to actin dynamics .
Current studies rely on epitope-tagged YSC84 due to the absence of a native antibody. Future work could develop YSC84-specific antibodies to:
Characterize untagged protein dynamics.
Investigate post-translational modifications (e.g., phosphorylation).
Validate cross-reactivity with SH3yl-1 in mammalian systems.
KEGG: sce:YHR016C
STRING: 4932.YHR016C
YSC84 is an actin-binding protein that plays a critical role in endocytosis in Saccharomyces cerevisiae. It localizes to endocytic sites after Las17/WASP but before other known actin-binding proteins, suggesting it functions at an early stage of membrane invagination . The protein contains a conserved N-terminal actin-binding domain (YAB domain) and a C-terminal SH3 domain that binds to Las17, the yeast WASP homologue . YSC84 represents a distinct class of actin-regulatory proteins conserved from yeast to humans, with the human homologue being SH3yl-1 . Its activity affects multiple stages of endocytosis, particularly during membrane invagination and vesicle scission.
YSC84 contains a unique N-terminal actin-binding domain called the YAB (Ysc84 Actin Binding) domain, which has no homology with other known actin-binding motifs . This domain is highly conserved across eukaryotes, with 43% identity between yeast and human homologues – a level of conservation higher than many other actin-binding proteins (compared to cofilin at 38%, profilin at 34%, and capping protein at 30%) . The C-terminal SH3 domain is critical for localization to endocytic sites through interaction with Las17 . Interestingly, full-length YSC84 cannot bind actin unless its SH3 domain simultaneously binds to Las17, indicating a regulatory mechanism that prevents non-specific actin binding .
For researchers working with YSC84 antibodies, several validated approaches exist. Immunoblotting can detect native YSC84 or tagged versions, as demonstrated by studies using GFP-tagged YSC84 variants . Immunofluorescence can be complemented with live cell imaging using fluorescently tagged YSC84 co-expressed with other endocytic markers like Sac6-mRFP . When developing an antibody-based detection strategy, researchers should consider epitopes outside the conserved functional domains to avoid interference with protein interactions. Validation controls should include YSC84 deletion strains, as these show distinct phenotypes including decreased plasma membrane lifetime of endocytic reporters .
When selecting antibodies for YSC84 detection, researchers should consider the specific domains being targeted. Antibodies recognizing the YAB domain (residues 1-180 approximately) may interfere with actin binding, making them suitable for inhibition studies but potentially problematic for co-immunoprecipitation of actin complexes . For studying YSC84-Las17 interactions, antibodies targeting regions outside the C-terminal SH3 domain are preferable. The conserved nature of the YAB domain (43% identity between yeast and human) should be considered when evaluating antibody specificity across species . For immunoprecipitation studies, researchers should avoid antibodies targeting the KK16,17, LK55,56, or RR176,177 regions, as mutations in these areas have been shown to significantly affect protein function .
Validation should include western blotting against wild-type and ysc84Δ strains to confirm specificity. The expression levels of YSC84 in different yeast strains can be variable, with overexpression strains showing approximately 19-fold higher expression than wild-type cells . If studying YSC84 mutations, researchers should verify that the antibody can recognize the mutant forms, as some mutations (particularly RL73,74AA) have shown reduced stability both in bacteria and yeast . Immunofluorescence validation should demonstrate co-localization with known endocytic markers such as Sac6-mRFP, as shown in previous studies .
Due to conservation between YSC84 and its homologues (like human SH3yl-1), antibodies may cross-react across species. This can be advantageous for comparative studies but requires careful validation. In S. cerevisiae specifically, researchers must consider potential cross-reactivity with Lsb3, the paralog of YSC84 resulting from whole genome duplication . When designing experiments to distinguish between these proteins, researchers should target less conserved regions outside the YAB domain. Any antibody claiming specificity for YSC84 over Lsb3 should be validated in strains expressing only one of these proteins.
To study YSC84-actin interactions, high-speed pelleting assays have proven effective . In these assays, YSC84 can be detected in both pellet fractions (indicating F-actin binding) and supernatant fractions (indicating G-actin or short actin multimer binding). Researchers using antibodies in these contexts should optimize incubation conditions, as studies have shown that overnight incubation at 4°C prior to centrifugation yields more reproducible results than shorter incubations at room temperature . For quantitative analysis, researchers should perform multiple replicate experiments and apply statistical analyses such as unpaired Student's t-tests to evaluate significance of binding differences, as demonstrated in studies of YSC84 mutants .
Live cell imaging using fluorescently tagged endocytic proteins has revealed that YSC84 affects the lifetimes of multiple endocytic proteins. When overexpressed, YSC84 increases the lifetimes of Sla1-GFP, Las17-GFP, Sac6-RFP, and Bbc1-GFP, while decreasing the lifetimes of later-arriving proteins like Myo3-GFP and Rvs167-GFP . For antibody-based detection of these dynamics, researchers can use fixed-cell immunofluorescence at different time points after endocytic stimulation. Kymograph analysis and patch tracking are essential for quantifying movement, as they can reveal aberrant behaviors such as the retractions toward the plasma membrane observed in YSC84 overexpression studies .
The functional relationship between YSC84 and Las17 is complex and requires sophisticated experimental approaches. Yeast two-hybrid assays and direct binding assays have confirmed that YSC84 and Rvs167 compete for binding sites on Las17 . Researchers using antibodies to study this relationship should design co-immunoprecipitation experiments that can detect competition between different SH3 domain-containing proteins for Las17 binding. When interpreting results, it's important to consider that YSC84 recruitment to endocytic sites depends on its SH3 domain interaction with Las17, while its actin-binding activity requires both this interaction and the N-terminal YAB domain .
YSC84 has distinct actin-binding and lipid-binding sites that are both essential for its function . To differentiate between these activities, researchers can use site-directed mutagenesis targeting specific residues. The KK16,17AA and RR176,177AA mutations specifically disrupt actin binding without affecting lipid binding, while the LK55,56AA mutation disrupts lipid binding without affecting actin binding . When designing antibody-based experiments to study these distinct functions, researchers should use antibodies that recognize epitopes away from these critical residues. In functional assays, it's important to note that YSC84's actin binding activity is negatively regulated by PI(4,5)P2, suggesting complex interplay between these binding activities .
GFP-tagging of YSC84 mutants has revealed that neither actin-binding mutations (KK16,17AA and RR176,177AA) nor lipid-binding mutations (LK55,56AA) prevent recruitment to endocytic sites, but all these mutations impair functionality . To distinguish between localization and function defects, researchers should combine localization studies (using antibodies or fluorescent tags) with functional assays in appropriate genetic backgrounds. The ysc84Δ, lsb5(1-142) strain provides a sensitized background where YSC84 function is essential for growth at elevated temperatures and for proper actin organization . When interpreting results, researchers should consider protein stability, as some mutations (particularly RL73,74AA) can destabilize the protein both in vitro and in vivo .
Several phenotypic readouts have proven valuable for assessing YSC84 function. Growth assays at 30°C and 37°C in the ysc84Δ, lsb5(1-142) background can reveal whether mutations compromise essential functions . Actin organization assessment using phalloidin staining can be categorized into four phenotypes: (1) both actin patches and cables; (2) only patches but largely polarized; (3) only patches but largely depolarized; (4) dispersed actin with elevated background staining . For endocytic function, lifetime measurements of endocytic reporters like Sla1-GFP provide quantitative readouts. When overexpressed, wild-type YSC84 increases Sla1-GFP lifetime by 30%, while actin-binding mutants fail to induce this phenotype . Researchers should implement these multiple readouts to comprehensively characterize mutant effects.
Contradictory results in YSC84 studies may arise from several factors. First, the interaction between YSC84 and actin is complex and condition-dependent – full-length YSC84 only binds actin when its SH3 domain binds to Las17 . Second, experimental conditions significantly affect results; for example, actin pelleting assays show more reproducible results after overnight incubation at 4°C compared to shorter times at room temperature . Third, YSC84 mutations can have variable expression levels, with some mutations (like RL73,74AA) showing significant instability . When reconciling contradictory results, researchers should carefully compare experimental conditions, genetic backgrounds, and protein expression levels. Antibody-based studies should verify that the antibodies used can recognize all relevant forms of the protein under the conditions tested.
Several factors contribute to variability in YSC84 phenotypes. Expression level is critical – overexpression of YSC84 produces robust and quantifiable phenotypes, showing a 19-fold higher expression than endogenous levels . Genetic background dramatically influences phenotype severity, with ysc84Δ alone showing subtle phenotypes while ysc84Δ, lsb5(1-142) displays severe temperature sensitivity and actin organization defects . Timing of observations is also critical – YSC84 affects different stages of endocytosis, and the prominence of different phenotypes may depend on which stage is examined. For antibody-based quantitative studies, researchers should standardize protein detection methods and use multiple time points to capture the dynamic nature of YSC84's contributions to endocytosis.
Analyzing the temporal dynamics of YSC84 requires sophisticated approaches. Live cell imaging with Sla1-GFP has revealed that YSC84 overexpression delays both invagination and scission stages of endocytosis . Kymograph analysis is particularly valuable, showing that YSC84 overexpression reduces the rate of inward movement of endocytic reporters by approximately 50% and causes retractions toward the plasma membrane in 34-38% of cases . For fixed-cell antibody-based studies, researchers should collect samples at precisely defined time points and quantify both the intensity and spatial distribution of signals. Correlative light and electron microscopy can provide ultrastructural context to antibody-based detection of YSC84 at different stages of endocytic vesicle formation.
Several emerging technologies could transform YSC84 research. Super-resolution microscopy techniques could reveal the nanoscale organization of YSC84 relative to other endocytic proteins, potentially clarifying its role in organizing actin during membrane invagination. Development of conformation-specific antibodies that distinguish between active and inactive YSC84 conformations could illuminate the regulatory mechanisms controlling its actin-binding activity. CRISPR-based genome editing for endogenous tagging could allow visualization of YSC84 at physiological expression levels, addressing concerns about overexpression artifacts. Proximity labeling approaches like BioID or APEX could identify the complete interaction network of YSC84 during different stages of endocytosis.
Developing YSC84-specific research tools presents several opportunities. Structure-guided design of inhibitory peptides that disrupt specific interactions (such as YSC84-Las17 binding) could provide temporal control over YSC84 function. Engineered antibody fragments (nanobodies or scFvs) could enable acute inhibition of specific YSC84 domains in live cells. Chemogenetic approaches that allow rapid degradation of YSC84 could overcome the limitations of conventional genetic deletion studies by allowing temporally controlled protein depletion. For quantitative studies, development of FRET-based biosensors that report on YSC84 conformational changes could illuminate how its activity is regulated in real time during endocytosis.
YSC84 research has implications beyond endocytosis. The novel actin-binding domain (YAB) represents a new class of actin regulators , and understanding its mechanism could reveal new principles of cytoskeletal regulation. The regulatory relationship between YSC84 and Las17/WASP connects to broader questions about coordination between nucleation promoting factors and actin-binding proteins. The conservation of YSC84 from yeast to humans (with SH3yl-1 showing 43% identity in the YAB domain) suggests fundamental importance in eukaryotic cell biology . Future research using YSC84 antibodies in diverse systems could reveal whether the regulatory mechanisms identified in yeast are conserved in mammalian cells, potentially identifying new targets for manipulation of cytoskeletal dynamics in health and disease contexts.