zc3h18 Antibody

What is ZC3H18 and what are its structural characteristics?

ZC3H18 is a nuclear protein with a canonical length of 953 amino acid residues and a molecular mass of 106.4 kDa in humans . It contains CCCH-type zinc finger domains that facilitate its nucleic acid binding capabilities . Despite its calculated molecular weight, ZC3H18 typically migrates at approximately 150 kDa in Western blot analysis due to post-translational modifications, particularly phosphorylation . The protein contains two CCCH zinc finger domains and is widely expressed across multiple tissue types . ZC3H18 gene orthologs have been identified in mouse, rat, bovine, frog, zebrafish, chimpanzee, and chicken species, indicating evolutionary conservation .

What cellular functions does ZC3H18 perform?

ZC3H18 serves as a multi-domain protein with several critical functions:

• RNA decay pathway regulation: ZC3H18 physically links the cap-binding complex (CBC) to the nuclear exosome targeting (NEXT) complex, facilitating exosome-mediated RNA decay .

• Transcriptional regulation: ZC3H18 binds directly to the E2FA site in the BRCA1 promoter and promotes E2F4 interaction with the adjacent E2FB site, preventing E2F1-mediated repression of BRCA1 transcription .

• Chromatin interaction: ChIP experiments demonstrate that ZC3H18 binds chromatin around transcription start sites (TSSs) and gene bodies of active transcription units .

• Competitive pathway modulation: ZC3H18 competes with ZFC3H1 for ARS2 binding, thereby antagonizing the ARS2-dependent PAXT pathway while promoting NEXT-mediated RNA decay .

Which applications have been validated for ZC3H18 antibodies?

Commercial ZC3H18 antibodies have been validated for multiple research applications:

Positive controls include HepG2 cells for WB applications and human tonsillitis/cervical cancer tissue for IHC .

How can I effectively modulate ZC3H18 expression for functional studies?

Several validated approaches exist for manipulating ZC3H18 expression:

• siRNA-mediated knockdown:

  • Effective siRNA sequences include: GGAATGAATTGTAGGTTTATA, GGCCGGTAGTTGATGAAATTT, and GCCTTACGCAGACCCTTATTA

  • Transfect into cells using standard lipid-based reagents

  • Verify knockdown by Western blot after 48-72 hours

• Stable shRNA knockdown:

  • Use lentiviral vectors containing the same sequences as above

  • Select with puromycin (2-3 μg/mL)

  • Isolate and expand resistant colonies

• Inducible depletion system:

  • Mini-auxin-inducible degron (mAID) tag system allows rapid depletion upon indole-3-acetic acid (IAA) addition

  • Complete depletion achieved within 16 hours of IAA treatment

• Overexpression:

  • Clone ZC3H18 into lentiviral vectors (e.g., pLV-CMV-FLAG)

  • Include epitope tags (FLAG, MYC) for detection

  • Select with appropriate antibiotics (e.g., puromycin at 2 μg/mL)

What are the crucial controls for ZC3H18 antibody-based experiments?

Rigorous controls are essential for reliable ZC3H18 antibody experiments:

• Positive controls:

  • Cell lines: HepG2 cells show robust endogenous ZC3H18 expression

  • Tissues: Human tonsillitis and cervical cancer tissues show detectable ZC3H18 expression

  • For tagged constructs, include wild-type ZC3H18 expression

• Negative controls:

  • siRNA/shRNA-mediated ZC3H18 knockdown samples

  • Isotype-matched control antibodies at equivalent concentrations

  • Secondary antibody-only controls

• Functional validation controls:

  • For interaction studies, include known binding partners (ARS2, CBP80, ZCCHC8)

  • For ChIP experiments, include known binding sites (e.g., E2FA site in BRCA1 promoter)

  • For rescue experiments, include both wild-type and mutant versions (e.g., W297E, ARMmut)

How should I design experiments to study ZC3H18 interactions with RNA decay machinery?

To investigate ZC3H18's role in RNA decay:

• Protein interaction analysis:

  • Immunoprecipitate ZC3H18 and blot for components of the NEXT complex (ZCCHC8, MTR4) and CBCA complex (ARS2, CBP80)

  • Test different salt concentrations (100-600 mM NaCl) to differentiate stable from transient interactions

  • Compare wild-type ZC3H18 with mutant variants (W297E affects CBC interaction; ARMmut disrupts ARS2 binding)

• Functional RNA decay assays:

  • Measure levels of NEXT-sensitive PROMPTs by RT-qPCR in control vs. ZC3H18-depleted cells

  • Compare the effects of ZC3H18 depletion with depletion of other NEXT components

  • Conduct rescue experiments with wild-type and mutant ZC3H18

• Domain mapping:

  • Generate truncation constructs (N-terminal and C-terminal fragments)

  • Perform co-immunoprecipitation with known partners

  • Fragment Z5 (residues 201-953) interacts with NEXT components but shows reduced CBCA binding

How can I investigate ZC3H18's role in transcriptional regulation?

ZC3H18 functions as a DNA-binding transcriptional regulator:

• Chromatin binding studies:

  • Perform ChIP-qPCR targeting promoter regions of genes like BRCA1, MYC, and GAPDH

  • Design primers to amplify regions containing E2F binding sites

  • Include input DNA and IgG controls for normalization

• Promoter binding analysis:

  • Conduct electrophoretic mobility shift assays (EMSAs) with purified ZC3H18 protein

  • Use labeled promoter fragments containing wild-type and mutated E2F sites

  • For BRCA1, ZC3H18 specifically binds the E2FA site but not the E2FB site

• Co-occupancy determination:

  • Perform ChIP-Re-ChIP to detect simultaneous binding of ZC3H18 and other factors (e.g., E2F4) on the same DNA sequence

  • Compare binding patterns with activating vs. repressive transcription factors

• Transcriptional output assessment:

  • Measure target gene expression by RT-qPCR after ZC3H18 manipulation

  • Use luciferase reporter assays with wild-type and mutant promoter constructs

  • Analyze epigenetic modifications (e.g., DNA methylation) at regulated promoters

What approaches can reveal ZC3H18's role in cancer biology?

ZC3H18 has emerging roles in cancer, particularly in esophageal cancer and through BRCA1 regulation:

• Expression analysis in tumors:

  • Compare ZC3H18 expression between tumor and adjacent normal tissues

  • Perform immunohistochemistry on tissue microarrays

  • ZC3H18 shows significantly higher expression in esophageal cancer tissues and correlates with adverse prognostic indicators

• Functional cancer phenotypes:

  • Assess effects of ZC3H18 knockdown on cancer cell proliferation, migration, and invasion

  • ZC3H18 knockdown reduces proliferation and increases apoptosis in esophageal cancer cell lines

  • Evaluate effects on DNA damage response pathways

• BRCA1 regulation mechanism:

  • Monitor BRCA1 expression after ZC3H18 depletion

  • Assess BRCA1 promoter methylation (increases from ~15% to ~50% after ZC3H18 depletion)

  • Measure DNMT1 recruitment to BRCA1 promoter by ChIP

• Homologous recombination proficiency:

  • ZC3H18 depletion reduces BRCA1 levels and impairs homologous recombination

  • This defect can be rescued by ectopic BRCA1 expression

  • Test sensitivity to PARP inhibitors and DNA-damaging agents

How can ZC3H18 protein structure-function relationships be investigated?

To dissect the functional domains of ZC3H18:

• Domain truncation analysis:

  • Generate systematic truncations (N-terminal, C-terminal, internal deletions)

  • Seven fragments (Z1-Z7) have been used to map functional regions

  • The C-terminal region contains a nuclear localization signal (residues 481-953)

• Point mutation studies:

  • W297E mutation (mouse equivalent W301E) disrupts CBC interaction

  • ARMmut (D188A, E190A, D193A, E195A, E203A, E205A) disrupts ARS2 binding

  • Both mutations prevent rescue of ZC3H18 depletion phenotypes

• Localization analysis:

  • Tag constructs with fluorescent proteins or epitope tags

  • Fragments Z4-Z7 show nuclear localization, while Z1-Z3 localize to both cytoplasm and nucleus

  • Use co-localization studies with interaction partners

• Functional complementation:

  • Deplete endogenous ZC3H18 and express mutant variants

  • Assess rescue of RNA decay function by measuring PROMPT levels

  • Evaluate protein-protein interactions by co-immunoprecipitation

Why might my Western blot for ZC3H18 show different molecular weights than expected?

Several factors can explain molecular weight discrepancies:

• Post-translational modifications:

  • Despite a calculated MW of 106.4 kDa, ZC3H18 typically migrates at ~150 kDa due to phosphorylation

  • Treatment with phosphatases can confirm modification status

• Isoform detection:

  • ZC3H18 has multiple isoforms with calculated MWs of 160 kDa and 84 kDa

  • Different antibodies may preferentially detect specific isoforms

• Technical considerations:

  • Use 6-8% gels for better resolution of high molecular weight proteins

  • Extend running time to improve separation

  • Verify with multiple antibodies targeting different epitopes

• Degradation products:

  • Include protease inhibitors in sample preparation

  • Minimize freeze-thaw cycles of samples

  • Prepare fresh samples when possible

How can I interpret conflicting results from different ZC3H18 antibodies?

When different antibodies yield inconsistent results:

• Epitope mapping:

  • Determine what regions each antibody targets

  • Anti-ZC3H18 antibodies have been raised against N-terminal, C-terminal, and internal regions

  • Some antibodies target residues 850-950, while others target fusion proteins of the full-length protein

• Isoform specificity:

  • Verify which isoforms are expressed in your experimental system by RT-PCR

  • Different antibodies may recognize different isoforms or miss splice variants

• Validation approach:

  • Test antibodies on ZC3H18 knockdown/knockout samples

  • Use tagged ZC3H18 constructs as positive controls

  • Compare results across multiple detection methods (WB, IF, IHC)

• Application optimization:

  • Each antibody may require specific conditions for optimal performance

  • Adjust fixation, antigen retrieval, and detection methods

  • Test multiple dilutions to find the optimal signal-to-noise ratio

What factors might influence ZC3H18 function across different experimental systems?

ZC3H18 function may vary due to:

• Cell type-specific effects:

  • ZC3H18 shows differential expression across tissues

  • Interaction partners may vary by cell type

  • In esophageal cancer, ZC3H18 promotes tumor growth and metastasis

  • In ovarian cancer models, ZC3H18 regulates BRCA1 expression and homologous recombination

• RNA processing context:

  • ZC3H18 both antagonizes and promotes different RNA decay pathways

  • It bridges CBCA and NEXT complexes while competing with ZFC3H1 for ARS2 binding

  • Balance between these functions may vary by cellular context

• Genetic background:

  • BRCA1 mutational status may affect ZC3H18's role in DNA repair

  • Deep ZC3H18 deletions and low ZC3H18 mRNA levels are nearly mutually exclusive with BRCA1 driver mutations

• Experimental design considerations:

  • Acute vs. chronic depletion may yield different phenotypes

  • Complete ZC3H18 depletion vs. partial knockdown

  • Different methods of manipulation (siRNA, shRNA, CRISPR, degron) have varying kinetics and potential off-target effects

How can ZC3H18's role in pathway competition be further investigated?

ZC3H18 competitively regulates RNA decay pathways:

• Competition quantification:

  • Perform co-immunoprecipitation of ARS2 with ZFC3H1 under varying ZC3H18 levels

  • ZC3H18 depletion leads to increased ARS2-ZFC3H1 association

  • Use titration experiments with tagged proteins to establish binding affinities

• Pathway-specific RNA targets:

  • Identify transcripts specifically regulated by NEXT vs. PAXT pathways

  • Compare effects of ZC3H18 depletion on these distinct substrate classes

  • Distinguish direct effects from indirect consequences of pathway perturbation

• Structural biology approaches:

  • Determine interaction interfaces between ZC3H18 and its binding partners

  • Design mutations that specifically disrupt individual interactions

  • Test functional consequences of selectively blocking certain interactions

What are the implications of ZC3H18's dual role in RNA metabolism and transcriptional regulation?

Integrating ZC3H18's multiple functions:

• Coordination analysis:

  • Investigate whether ZC3H18 simultaneously regulates transcription and RNA decay of the same genes

  • Study whether chromatin binding and RNA processing are mutually exclusive or coordinated activities

  • Develop methods to distinguish ZC3H18's role at different steps of gene expression

• Mechanistic transition:

  • Determine signals that shift ZC3H18 between its transcriptional and post-transcriptional roles

  • Investigate post-translational modifications that might regulate functional switching

  • Analyze protein complex composition in different cellular compartments

• Disease relevance:

  • Explore whether dysregulation of this dual functionality contributes to cancer progression

  • In esophageal cancer, ZC3H18 promotes tumor growth

  • In BRCA1-proficient cancers, ZC3H18 regulates DNA repair through transcriptional control