CD244 Human

What is CD244 and what are its alternative nomenclatures in scientific literature?

CD244 is an immunoregulatory receptor belonging to the Signaling Lymphocyte Activation Molecule (SLAM) family. In scientific literature, it may also be referred to as 2B4 or SLAM family 4 . This transmembrane glycoprotein contains immunoreceptor tyrosine-based switch motifs (ITSMs) in its cytoplasmic domain, which are critical for its signaling functions . CD244 interacts with CD48, its natural ligand, which is broadly expressed on hematopoietic cells . Understanding these alternative names is essential when conducting literature reviews to ensure comprehensive coverage of relevant research.

Which immune cell types express CD244 in humans?

CD244 is expressed on multiple immune cell populations in humans, including:

• Natural killer (NK) cells

• A subset of CD8+ T cells (particularly exhausted T cells)

• Dendritic cells (DCs)

• Myeloid-derived suppressor cells (MDSCs)

The expression level varies significantly between peripheral blood and tumor microenvironments, with typically higher expression observed in tumor-infiltrating immune cells . For research purposes, flow cytometry using anti-CD244 antibodies (such as clone C1.7 for human samples) is commonly used to identify CD244-expressing cells, with CD244-knockout mice cells serving as negative controls for specificity verification .

How does CD244 structure in humans differ from mouse homologs?

In humans, two isoforms of CD244 are expressed through differential splicing of hnRNA. Unlike mouse CD244, both human isoforms have identical intracellular domains containing four ITSMs . The structural difference between the human isoforms lies in the extracellular domain - specifically, the shorter isoform lacks five amino acids between the immunoglobulin V and C2 domains .

This contrasts with mouse CD244, which has two distinctly different isoforms: a long form with four ITSMs and a short form with only one ITSM . These structural differences have functional consequences, as the shorter human isoform shows increased affinity for CD48 and its engagement results in enhanced calcium flux and NK cell-mediated cytotoxicity in vitro . These species-specific differences must be considered when translating findings from mouse models to human applications.

How does CD244 expression differ between normal tissues and tumor environments?

Research demonstrates significant upregulation of CD244 expression in tumor microenvironments compared to healthy tissues. Studies in head and neck squamous cell carcinoma (HNSCC) found that:

• Tumor-infiltrating CD8+ T cells showed significantly increased CD244 expression compared to their counterparts in healthy tissues

• Intratumoral dendritic cells and MDSCs exhibited higher CD244 expression than those in peripheral blood

• This elevated expression correlated with increased expression of immunosuppressive mediators

The upregulation of CD244 in tumor-infiltrating immune cells suggests its role in promoting the immunosuppressive tumor microenvironment. For accurate assessment of CD244 expression differences, matched samples from both tumor and adjacent normal tissues should be analyzed simultaneously using identical protocols and antibody clones .

What is the prognostic value of CD244 expression in human cancers?

CD244 expression has emerging value as a prognostic biomarker in several cancer types. A comprehensive analysis across multiple cancer datasets revealed that:

• In uterine corpus endometrial carcinoma (UCEC), patients with higher CD244 expression showed improved survival outcomes (HR = 0.645, 95% CI: 0.433–0.961, p = 0.031)

• CD244 expression levels should be analyzed in context with other clinical variables

The following table from recent research illustrates the prognostic significance of CD244 expression in UCEC:

These findings suggest that CD244 expression analysis should be incorporated into comprehensive immune profiling of tumors for more accurate prognostication .

What are the key molecular mechanisms underlying CD244 signaling in immune cells?

CD244 signaling is remarkably complex and depends on the availability of specific adaptor molecules. The primary mechanism involves:

• Upon engagement with CD48, the ITSMs in CD244's cytoplasmic domain become phosphorylated

• These phosphorylated motifs recruit either:

  • SAP (SLAM-associated protein), leading to activating signals

  • Phosphatases (SHP-1, SHP-2, SHIP, Csk), resulting in inhibitory signals

The signaling outcome depends on the relative concentration of these adaptor molecules. In human NK cells, the first, second, and fourth ITSMs activate NK-mediated cytotoxicity by binding SAP, while the third ITSM binds phosphatases and inhibits NK cytotoxicity . Importantly, the binding of SAP and phosphatases to ITSMs is mutually exclusive, making SAP levels critical for determining whether CD244 delivers activating or inhibitory signals .

For studying these molecular interactions, co-immunoprecipitation followed by immunoblotting is commonly employed to detect interactions between CD244 and its downstream signaling partners.

How does CD244 contribute to T cell exhaustion in cancer and chronic infections?

CD244 plays a significant role in T cell exhaustion through several mechanisms:

• CD244 expression increases on CD8+ T cells during chronic antigen exposure, correlating with an exhausted phenotype

• High CD244 expression on CD8+ T cells correlates with PD1 expression, another established exhaustion marker

• SAP expression decreases in effector CD8+ T cells over time, potentially shifting CD244 signaling from activating to inhibitory

• CD244hi CD8+ T cells show decreased proliferation and cytokine production compared to CD244lo cells

In human studies, CD244 expression is higher on virus-specific CD8+ T cells in patients with chronic infections than those with acute infections . Importantly, ex vivo blockade of CD244 using anti-CD244 monoclonal antibodies on human CD244+CD8+ T cells leads to increased virus-specific T cell proliferation, enhanced expression of degranulation markers, and increased cytokine production . These findings support CD244 as both a marker and mediator of T cell exhaustion.

What preclinical evidence supports CD244 as a therapeutic target in cancer immunotherapy?

Several key findings support CD244 as a promising immunotherapeutic target:

• CD244-/- mice showed significantly impaired tumor growth of HNSCC compared to wild-type mice

• Interventional treatment of wild-type mice with anti-CD244 monoclonal antibodies significantly impaired the growth of established HNSCC tumors

• Anti-CD244 treatment increased tumor-infiltrating CD8+ T cells in mouse models

• In vivo administration of anti-CD244 mAb significantly decreased the number of B16F10 syngeneic melanoma lung nodules in wild-type mice following intravenous injection

• CD244 blockade reversed NK cell exhaustion in co-culture experiments with tumor-associated CD48hi monocytes/macrophages

These preclinical findings demonstrate that targeting CD244 can potentially reverse immune exhaustion and enhance anti-tumor immunity. For translational research, it's critical to evaluate both the efficacy and potential side effects of CD244 blockade, as CD244 is expressed on multiple immune cell types .

How might combination approaches incorporating CD244 blockade enhance cancer immunotherapy?

Given the correlation between CD244 and other immune checkpoint molecules, combination approaches may offer enhanced therapeutic benefits:

• CD244 expression correlates with PD-1 on CD8+ T cells and PD-L1 on dendritic cells and MDSCs, suggesting potential synergy between CD244 blockade and PD-1/PD-L1 inhibitors

• CD244 functions across multiple immune cell types (NK cells, CD8+ T cells, DCs, MDSCs), potentially offering broader immune reactivation than single checkpoint inhibitors

• Combination approaches could address resistance mechanisms to existing immunotherapies

When designing combination studies, researchers should consider:

• Sequential vs. concurrent administration protocols

• Potential for additive toxicities

• Mechanistic studies to understand the basis of synergy or antagonism

• Biomarker development to identify patients most likely to benefit from combination approaches

What techniques are recommended for measuring CD244 expression in clinical samples?

For comprehensive assessment of CD244 expression in clinical samples, several complementary techniques are recommended:

• Flow Cytometry: The gold standard for analyzing CD244 expression on specific immune cell subsets.

  • Critical parameters include using validated anti-CD244 antibodies (e.g., clone C1.7 for human samples)

  • Include proper controls such as fluorescence-minus-one (FMO) or CD244-knockout cells

  • Combined with markers to identify specific immune cell populations (CD8, CD11c, etc.)

• Quantitative RT-PCR: For RNA-level expression analysis.

  • Validated primers for human CD244: H2B4-A-373+1F (GTATTTGATAAAGTTGAGAAACCCCG) and H2B4−558+1R (GCAGGTATATGTGTGAGTGCCATTA)

  • Normalization against housekeeping genes such as ubiquitin

• Immunohistochemistry: For spatial analysis of CD244 expression in tissue sections.

• Single-cell RNA sequencing: For comprehensive profiling of CD244 expression across cell types.

For clinical translation, standardized protocols are essential to ensure reproducibility and comparability across patient samples and research centers.

How can single-cell analysis enhance our understanding of CD244's role in the tumor microenvironment?

Single-cell technologies offer unique insights into CD244 biology that bulk analysis methods cannot provide:

• Single-cell RNA sequencing: Enables identification of specific cell subpopulations expressing CD244 and analysis of associated gene expression patterns.

  • Can reveal heterogeneity in CD244 expression within seemingly homogeneous cell populations

  • Allows correlation of CD244 expression with exhaustion signatures and other functional states

• Mass cytometry (CyTOF): Permits simultaneous detection of CD244 with dozens of other proteins at single-cell resolution.

• Spatial transcriptomics: Combines single-cell resolution with spatial information, revealing the topography of CD244-expressing cells within the tumor microenvironment.

Recent studies have utilized single-cell approaches to explore the relationship between CD244 expression and immune infiltration in uterine corpus endometrial carcinoma using the DISCO database . These approaches are particularly valuable for understanding the complexity of CD244 expression and function in heterogeneous tumor environments.

What are the main research challenges in translating CD244-targeted therapies to clinical applications?

Several challenges must be addressed to successfully translate CD244-targeted therapies:

• Dual signaling nature: CD244 can mediate both activating and inhibitory signals depending on the cellular context and adaptor molecule availability . This complexity requires careful consideration in therapeutic design.

• Broad expression pattern: CD244 is expressed on multiple immune cell types with potentially different functions in each context . Therapeutic approaches must consider these diverse effects.

• Biomarker development: Identifying predictive biomarkers for response to CD244-targeted therapies, such as SAP/EAT-2 expression levels or CD244 isoform distribution .

• Optimal blocking strategies: Determining whether targeting CD244, its ligand CD48, or both would provide optimal therapeutic effects.

• Potential adverse effects: Given CD244's role in normal immune function, anticipating and mitigating potential immune-related adverse events.

Addressing these challenges requires interdisciplinary collaboration between basic scientists, translational researchers, and clinicians to develop effective and safe CD244-targeted therapies.

What emerging technologies might advance CD244 research in the near future?

Several emerging technologies have potential to significantly advance CD244 research:

• CRISPR-Cas9 gene editing: For creating precise CD244 modifications to study structure-function relationships and isoform-specific roles.

• Humanized mouse models: Better recapitulating human CD244 biology, given the structural and functional differences between human and mouse CD244 .

• Bispecific antibodies: Targeting CD244 simultaneously with other immune checkpoint molecules for enhanced efficacy.

• Advanced imaging techniques: Such as intravital microscopy to study CD244-CD48 interactions in real-time in living tissues.

• AI and machine learning: For integrating multi-omics data to identify novel patterns in CD244 expression and function across different cancer types and patient populations .

• Organoid models: Providing more physiologically relevant systems to study CD244 function in three-dimensional tissue architecture.

These technologies could help address current knowledge gaps and accelerate the translation of CD244-targeted therapies into clinical applications.