CKMT1 Human

What is CKMT1 and what is its primary function?

CKMT1 (Mitochondrial Creatine Kinase 1) is a mitochondrial isozyme of creatine kinases that plays a critical role in cellular energy metabolism. The enzyme reversibly catalyzes the transfer of phosphate between ATP and creatine phosphate, functioning as an ATP-buffering system in cells with high and fluctuating energy demands. This phosphotransfer reaction can be represented as:

ATP + Creatine ⟺ ADP + Phosphocreatine

Beyond energy metabolism, CKMT1 contributes to mitochondrial homeostasis, oxidative stress management, and regulation of apoptotic pathways. Recent research has demonstrated that CKMT1 is involved in maintaining intestinal epithelial barrier function and protecting against cell death during inflammatory conditions . These diverse functions position CKMT1 as a multifunctional enzyme with implications for both normal physiology and various pathological conditions.

Where is CKMT1 expressed in human tissues?

CKMT1 exhibits a tissue-specific expression pattern with particularly high levels in tissues with elevated energy demands. According to data from the Human Protein Atlas project, CKMT1 is highly expressed throughout the gastrointestinal tract, including the esophagus, small intestine, and colon . This distribution pattern suggests that CKMT1 plays an indispensable role in maintaining physiological functions in the gut.

Within the intestinal epithelium, immunofluorescence staining has revealed extensive co-localization between CKMT1 and markers for intestinal epithelial cells such as Occludin and EpCAM. This indicates that CKMT1 is predominantly expressed in intestinal epithelial cells in the colon . The enzyme is also expressed in various other tissues, with significant expression observed in striated muscle and heart tissues, consistent with its function in energy-demanding tissues.

What is the subcellular localization of CKMT1?

CKMT1 is primarily localized to mitochondria, consistent with its classification as a mitochondrial creatine kinase isoform. Within mitochondria, CKMT1 is associated with the inner membrane and intermembrane space, where it can efficiently interact with proteins involved in energy transfer across mitochondrial membranes .

This strategic positioning allows CKMT1 to efficiently couple ATP generation in the mitochondria with its transfer to the cytosol as phosphocreatine. Interestingly, research has demonstrated that a fraction of cyclin-dependent kinase 4 (CDK4) proteins colocalize and interact with CKMT1 at mitochondria, suggesting a novel role for CKMT1 in cell cycle regulation beyond its classical energy metabolism function .

What are the key structural features of CKMT1?

Human CKMT1 is a glycosylated polypeptide chain with a molecular weight of approximately 47 kDa. According to recombinant protein specifications, CKMT1 contains specific structural domains including a functionally important DH domain that mediates protein-protein interactions, particularly with CDK4 .

The enzyme typically functions as a dimer in vivo, similar to other creatine kinase isoforms, which allows for cooperative binding and enhanced catalytic efficiency. When purified for research purposes, recombinant CKMT1 is typically produced in expression systems such as Pichia Pastoris and purified through chromatographic techniques to achieve greater than 95% purity as determined by RP-HPLC and SDS-PAGE analyses .

The biological activity of purified CKMT1 can be measured by enzymatic assays, with reports indicating specific activity of around 537 IU/mg at 37°C, corresponding to approximately 1,863 ng/ml . These structural characteristics and enzymatic properties are important considerations for researchers studying CKMT1 function in vitro and in vivo.

How can researchers generate CKMT1 knockout cell lines?

Generation of CKMT1 knockout cell lines is effectively achieved using the CRISPR-Cas9 system, as documented in several studies. The following protocol outlines a systematic approach based on published methodologies:

• sgRNA Design and Cloning:

  • Design single-guide RNAs (sgRNAs) targeting CKMT1 using established tools such as those from Zhang's laboratory (http://crispr.mit.edu/)

  • Previously validated sgRNA sequences include:

    • sgRNA1: TACGAGCTGCCAGTGAACGA

    • sgRNA2: GGACCGACTAGGCAAATCAG

  • Clone selected sgRNAs into a lentiviral CRISPR vector such as Lenti-CRISPER v2 vector (Addgene#52961)

• Lentiviral Particle Production:

  • Produce lentiviral particles in 293T cells using standard transfection protocols

  • Collect viral supernatant and filter for subsequent transduction

• Target Cell Transduction and Selection:

  • Transduce target cells with lentiviral particles containing CKMT1-targeting sgRNAs

  • Select transduced cells using puromycin (typically at 1 μg/ml)

  • Isolate single cell clones through limiting dilution or cell sorting

• Validation of CKMT1 Knockout:

  • Confirm gene editing by DNA sequencing of the targeted region

  • Verify loss of CKMT1 protein expression by Western blot

  • Perform functional validation through enzymatic activity assays or phenotypic assays

Alternative approaches for reducing CKMT1 expression include RNA interference methods:

• Stable knockdown using shRNA expressed from lentiviral vectors

• Transient knockdown using siRNA transfection

The choice between these methods depends on the specific research questions, with CRISPR-Cas9 offering complete protein elimination while RNAi provides flexibility for dose-dependent and reversible reduction in expression .

What is the role of CKMT1 in inflammatory bowel disease?

Expression Pattern in UC:

• CKMT1 protein expression is markedly decreased in colon tissues of UC patients compared to healthy controls, demonstrated by both immunohistochemistry and Western blotting

• Similar downregulation is observed in dextran sodium sulfate (DSS)-induced experimental colitis in mice

Mechanistic Role in Intestinal Homeostasis:

• Mitochondrial Function: CKMT1 deficiency leads to mitochondrial dysfunction in intestinal epithelial cells. Loss of CKMT1 increases mitochondrial reactive oxygen species (ROS) generation during inflammation, specifically promoting TNF-α-induced ROS via reverse electron transfer (RET) .

• Protection Against Apoptosis: CKMT1 expression limits activation of both intrinsic and extrinsic apoptotic pathways in intestinal epithelial cells. During intestinal inflammation, CKMT1 prevents excessive apoptosis of epithelial cells by inhibiting RET-ROS-mediated mitochondrial permeability transition pore (mPTP) opening .

• Barrier Integrity: CKMT1 is crucial for maintaining the integrity of the intestinal epithelial barrier, which becomes compromised during IBD progression.

Experimental Evidence:

• Intestinal epithelial-specific CKMT1 knockout mice demonstrate increased susceptibility to DSS-induced colitis

• TUNEL staining revealed increased colonic apoptosis in these knockout mice

• Western blotting showed elevated expression of cleaved-caspase 3 in colon tissue of knockout mice during DSS-induced colitis

The consistent downregulation of CKMT1 in both human UC and mouse models, coupled with mechanistic insights into its protective functions, suggests that CKMT1 could represent a promising therapeutic target for inflammatory bowel disease.

How does CKMT1 regulate apoptosis in cellular stress conditions?

CKMT1 plays a multifaceted role in protecting cells from apoptosis, particularly under inflammatory and oxidative stress conditions. The mechanisms underlying this protection have been elucidated through various experimental approaches:

Inhibition of Apoptotic Pathway Activation:
CKMT1 expression limits the activation of both intrinsic and extrinsic apoptotic pathways in cells, as demonstrated particularly in intestinal epithelial cells:

• Regulation of Intrinsic Apoptotic Pathway:

  • CKMT1 deficiency leads to increased mitochondrial permeability transition pore (mPTP) opening

  • This results in cytochrome c release from mitochondria into the cytosol

  • Released cytochrome c activates caspase cascades, leading to apoptosis

  • CKMT1 presence helps maintain mitochondrial membrane integrity, preventing this cascade

• Modulation of Extrinsic Apoptotic Pathway:

  • TNF-α is a critical proinflammatory mediator that can induce apoptosis

  • CKMT1 limits TNF-α-induced apoptosis as demonstrated in cellular models

  • Specifically, CKMT1 knockdown increases sensitivity to TNF-α/cycloheximide (CHX)-induced apoptosis

• Control of Reactive Oxygen Species (ROS):

  • CKMT1 deficiency increases TNF-α-induced mitochondrial ROS generation via reverse electron transfer (RET)

  • This RET-ROS promotes mPTP opening, ultimately leading to cell apoptosis during inflammation

  • By limiting ROS generation, CKMT1 indirectly inhibits apoptosis initiation

Experimental Evidence:
Evidence from both in vivo and in vitro models supports CKMT1's anti-apoptotic role:

• In CKMT1-knockout mice, TUNEL staining revealed increased colonic apoptosis

• Western blotting showed elevated expression of cleaved caspase-3 in colon tissue of knockout mice during DSS-induced colitis

• In cell culture models, CKMT1 knockdown in Lovo cells resulted in significantly increased expression of apoptosis markers after TNF-α/CHX treatment, including cleaved-PARP, cleaved-caspase 3, and Bax

• Conversely, CKMT1 overexpression in NCM460 cells (a normal colon epithelial cell line) reduced TNF-α-induced apoptosis

These mechanisms highlight CKMT1's critical role in cell survival under stress conditions, explaining why its dysregulation contributes to pathologies characterized by excessive cell death, such as inflammatory bowel disease.

How does CKMT1 interact with the cell cycle machinery?

Recent research has revealed a novel role for CKMT1 in cell cycle regulation, particularly in non-small cell lung cancer (NSCLC), through its direct interaction with cyclin-dependent kinase 4 (CDK4):

Direct Interaction with CDK4:

• Protein mass spectrometry identified CDK4 as a CKMT1-interacting protein

• This interaction was validated through Co-immunoprecipitation (Co-IP) and GST-pull down experiments

• The crucial binding domains were identified as the DH domain of CKMT1 and both N- and C-terminal regions of CDK4

• Immunofluorescence studies revealed that a fraction of CDK4 proteins colocalizes with CKMT1 at mitochondria

Functional Impact on Cell Cycle Progression:

• Regulation of CDK4 Activation:

  • CKMT1 regulates CDK4 phosphorylation, which is crucial for its activation

  • CKMT1 may assist in either the activation or nuclear translocation of CDK4

• G1-S Phase Transition:

  • CKMT1 promotes the G1-S phase transition in the cell cycle

  • CKMT1 knockdown results in G1 phase arrest, with increased G0/G1 fraction and decreased S phase cell fraction

  • This effect is mediated through its interaction with CDK4, a key regulator of the G1-S transition

• Cell Proliferation:

  • Through its role in cell cycle regulation, CKMT1 significantly influences cell proliferation

  • CKMT1 knockdown suppresses proliferation in NSCLC cell lines

  • CKMT1 overexpression enhances proliferation

  • Re-expression of CKMT1 in knockout cells rescues the proliferation phenotype

Therapeutic Implications:
The interaction between CKMT1 and CDK4 has important implications for cancer therapy:

• CKMT1 renders NSCLC resistant to G2/M cell cycle antagonists like paclitaxel (TAX)

• Decreasing CKMT1 expression increases the antitumor effect of paclitaxel both in vitro and in vivo

• This suggests that targeting CKMT1 could enhance the efficacy of cell cycle-targeted cancer therapies

This non-canonical role of CKMT1 in cell cycle regulation represents a significant advancement in our understanding of how metabolic enzymes can directly influence cell proliferation control, providing new avenues for therapeutic intervention in cancer.

What is the role of CKMT1 in different cancer types?

CKMT1 exhibits context-dependent roles across different cancer types, with emerging evidence suggesting it may function as both an oncogenic driver and a potential therapeutic target:

1. Non-Small Cell Lung Cancer (NSCLC):

CKMT1 displays oncogenic properties in NSCLC:

• Expression is significantly increased in NSCLC compared to normal lung tissue

• CKMT1 promotes proliferation of NSCLC cells both in vitro and in vivo

• Knockdown significantly suppresses proliferation in PC9 and A549 cells

• Overexpression enhances proliferation in H1299 cells

Mechanistically, CKMT1 regulates the cell cycle in NSCLC through:

• Direct interaction with cyclin-dependent kinase 4 (CDK4)

• Regulation of CDK4 phosphorylation and potential nuclear translocation

• Promotion of G1-S phase transition, driving cell proliferation

Therapeutic implications include:

• CKMT1 expression renders NSCLC resistant to G2/M cell cycle antagonists like paclitaxel

• Decreasing CKMT1 expression increases paclitaxel efficacy both in vitro and in vivo

2. EVI1-Driven Acute Myeloid Leukemia (AML):

CKMT1 is implicated in leukemia progression:

• Highly expressed in EVI1-positive AML cells

• Promotes growth of EVI1-positive AML cells both in vitro and in vivo

• Depletion suppresses the growth of EVI1-expressing AML cell lines

The regulatory mechanism involves:

• EVI1 binding to the RUNX1 promoter to reduce its expression

• Prevention of RUNX1-mediated CKMT1 repression, resulting in elevated CKMT1 levels

• Enhanced metabolism of arginine to creatinine, supporting cancer cell growth

Therapeutic potential:

• CKMT1 may be a therapeutic target in this subset of AML

• Targeting CKMT1 to block the creatine kinase pathway may benefit patients with EVI1-driven AML

Table 1: Contrasting Roles of CKMT1 in Different Disease Contexts

These contrasting roles highlight the context-dependent nature of CKMT1 function and suggest that therapeutic strategies targeting this enzyme must be tailored to specific disease contexts.