DNALI1 Human

What is the genomic location and structure of the human DNALI1 gene?

DNALI1 is located on chromosome 1 region p35.1 in humans. It is the human homolog of the Chlamydomonas inner dynein arm gene p28, which plays an important role in ciliary movement. The gene encodes a dynein light intermediate polypeptide that is essential for proper axonemal function . DNALI1 has multiple coding transcripts (ENST00000296218, ENST00000541606) as identified in gene expression analysis platforms .

What are the primary biological functions of DNALI1?

DNALI1 functions primarily as a component of the inner dynein arm (IDA) of cilium and flagellum axonemes, responsible for cilium and flagellum movement. It's particularly important in the context of sperm flagellar development, where it interacts with the MEIG1/PACRG complex within the manchette, a transient structure present in elongating spermatids . DNALI1 participates in the transport of cargo proteins required for proper sperm flagellum assembly. Additionally, it has been implicated in immune microenvironment modulation in certain cancer types, suggesting diverse biological roles beyond motile cilia function .

How is DNALI1 expression regulated in different human tissues?

DNALI1 transcripts are detected in several ciliated structures, with particularly notable expression in sperm flagella, suggesting tissue-specific regulation related to ciliary function . In pathological contexts, DNALI1 shows differential expression patterns, with high expression observed in high-grade ovarian cancer and various expression levels across different cancer types . The gene demonstrates variable expression in low-grade glioma (LGG) tissues, which correlates with prognosis. Regulatory mechanisms controlling DNALI1 expression in different tissues remain an active area of investigation .

What role does DNALI1 play in spermatogenesis and male fertility?

DNALI1 is essential for proper sperm development and male fertility. Research using conditional knockout mouse models has demonstrated that DNALI1 deficiency in male germ cells results in dramatic reduction of sperm cells and consequent male infertility . Specifically, DNALI1 is required for:

• Proper manchette function during spermiogenesis

• Correct sperm head shaping

• Normal flagellar development

• Sperm spermiation/individualization

In DNALI1-deficient mice, the majority of sperm cells exhibit abnormal morphology, including misshapen heads, bent tails, enlarged midpiece, and discontinuous accessory structures . These findings emphasize DNALI1's critical role in multiple aspects of sperm differentiation.

How does DNALI1 interact with other proteins during spermatogenesis?

DNALI1 interacts with several key proteins during spermatogenesis:

• It recruits and stabilizes PACRG, as demonstrated through co-immunoprecipitation and pull-down approaches

• It co-localizes with PACRG in the manchette of elongating spermatids

• It is required for the proper formation of the MEIG1/PACRG complex within the manchette

• It binds to dynein heavy chain 1 protein (DYNC1H1), which is also present in the manchette

These interactions are critical for the intramanchette transport (IMT) of cargo proteins like SPAG16L, which are essential for building the sperm flagellum . Additionally, DNALI1 may interact with γ-actin, potentially explaining its role in spermiation/individualization beyond the MEIG1/PACRG complex functions .

How is DNALI1 implicated in cancer development and progression?

Additionally, DNALI1 has been found to be highly expressed in high-grade ovarian cancer, suggesting potential involvement in tumor progression . It has also been linked to other malignancies, including breast carcinoma, osteosarcoma, and nasopharyngeal carcinoma, although the precise mechanisms of DNALI1's role in these cancers require further investigation .

What is known about DNALI1 mutations in human diseases?

DNALI1 mutations have been implicated in several pathological conditions. Notably, DNALI1 mutations can impair the integration of axoneme structure and affect sperm motility, leading to azoospermia . Although DNALI1 was initially considered a potential candidate gene for immotile cilia syndrome (ICS) due to ultrastructural defects of inner dynein arms seen in ICS patients, recent research with DNAH12-deficient models suggests that DNALI1's role may be more specific to flagellar development rather than cilial development .

DNALI1 has also been related to neurodegenerative conditions including frontotemporal lobar degeneration and Alzheimer's disease, as well as respiratory conditions like allergic rhinitis, although the causal mechanisms remain unclear .

What experimental approaches are most effective for studying DNALI1 protein interactions?

Based on published research, several complementary approaches have proven effective for studying DNALI1 protein interactions:

• Co-immunoprecipitation (Co-IP): Used successfully to demonstrate in vivo interactions between DNALI1 and PACRG in mouse testis protein extracts

• Bacterial co-expression systems: Co-expression of DNALI1 and His-tagged PACRG in BL21 cells, followed by nickel affinity chromatography, has been used to examine protein associations

• Pull-down assays: Effective for confirming direct protein-protein interactions

• Immunofluorescence co-localization: Used to visualize DNALI1 co-localization with other proteins like α-tubulin and PACRG in cellular structures such as the manchette

• Yeast two-hybrid screening: Successfully employed to identify potential binding partners like γ-actin

These methods collectively provide robust evidence of protein-protein interactions at different levels of biological organization.

What are the recommended protocols for detecting DNALI1 expression in human tissues?

For detecting DNALI1 expression in human tissues, the following validated approaches are recommended:

• qRT-PCR: PrimePCR assays for DNALI1 have been validated with high efficiency (105%) and specificity (100%) . The assay employs SYBR Green detection with intron-spanning primers to minimize genomic DNA amplification.

  • Amplicon context sequence: GAAGCACAATGAGGAGATTCAGTTCCTGAAGCGAACAAATCAGCAGCTGAAGGCCCAACTGGAAGGCATTATTGCACCAAAGAAGTGATAATTTCCACATGATTAATTTCCAACAAGACACTTGGGAGTTATTTACTGTGTTCCTCTGGCAGCCAATAAAATCATCATAAGCCCTTTGT

  • Amplicon length: 149 bp

  • Chromosome location: 1:38027795-38030753

• Western blotting: Successfully used to detect DNALI1 protein in tissue lysates using specific antibodies against DNALI1

• Immunohistochemistry/Immunofluorescence: Effective for localizing DNALI1 in tissue sections, particularly in ciliated structures

These complementary approaches allow for comprehensive analysis of DNALI1 expression at both the mRNA and protein levels, as well as its spatial distribution within tissues.

How do gene knockout models inform our understanding of DNALI1 function?

Conditional knockout models have provided critical insights into DNALI1 function:

• Germ cell-specific DNALI1 knockout mice: Generated using the Cre-loxP system (with three ES cell clones from HelmholtzZentrum munchen), these models demonstrate:

  • Dramatic reduction in sperm cells leading to male infertility

  • Abnormal sperm morphology (misshapen heads, bent tails, enlarged midpiece)

  • Impaired sperm spermiation/individualization

  • Normal manchette organization but disrupted localization of MEIG1, PACRG, and SPAG16L within the manchette

• Comparative analysis with other knockout models: Comparison of DNALI1-deficient mice with MEIG1 and PACRG-deficient mice reveals both overlapping and distinct phenotypes, indicating that DNALI1 has functions beyond its involvement in the MEIG1/PACRG complex

These knockout models have been instrumental in elucidating DNALI1's tissue-specific functions and its role in protein complexes essential for sperm development.

What are the differences between DNALI1's role in flagella versus cilia?

Research indicates distinct roles for DNALI1 in flagella versus cilia development:

In DNAH12-deficient models, which show male infertility due to impaired flagellar development:

These findings suggest that:

• The assembly of inner dynein arm components differs between flagella and cilia

• DNALI1's involvement appears more critical in flagellar development than in cilial development

• There may be tissue-specific mechanisms governing DNALI1 incorporation into axonemal structures

This distinction is important for understanding why mutations affecting DNALI1 function may cause male infertility without necessarily causing primary ciliary dyskinesia symptoms.

How does DNALI1 influence the tumor microenvironment in cancer?

Emerging research suggests DNALI1 may influence the tumor microenvironment, particularly in low-grade glioma:

• High DNALI1 expression correlates with poor prognosis in LGG patients

• Bioinformatic analysis suggests DNALI1 may play an important role in maintaining an immunosuppressive microenvironment

• Gene set enrichment analysis and evaluation of immune scores and immune checkpoints have been used to characterize the relationship between DNALI1 expression and immune activity in the tumor microenvironment

The specific mechanisms by which DNALI1 modulates immune activity in cancer contexts remain to be fully elucidated, but this represents an important area for future investigation, particularly given DNALI1's established role in cellular structures rather than immune function.

What are the primary technical challenges in studying DNALI1 protein function?

Several technical challenges complicate the comprehensive study of DNALI1:

• Transient nature of developmental structures: DNALI1 functions in transient structures like the manchette during spermatogenesis, making temporal studies challenging

• Multiple protein interactions: DNALI1 participates in complex protein networks (MEIG1/PACRG complex, dynein assembly), requiring sophisticated methods to dissect specific interactions

• Tissue-specific functions: The distinct roles of DNALI1 in different ciliated/flagellated tissues necessitate tissue-specific approaches

• Functional redundancy: Potential compensation by other dynein components may mask DNALI1's functions in certain experimental contexts

Addressing these challenges requires combinations of conditional knockout models, high-resolution imaging, proteomics approaches, and tissue-specific analyses.

What are promising avenues for therapeutic targeting of DNALI1 in disease contexts?

Based on current understanding of DNALI1 biology, several therapeutic approaches warrant investigation:

• Cancer therapy: Given DNALI1's correlation with poor prognosis in LGG and its potential role in maintaining an immunosuppressive microenvironment, targeting DNALI1 or its downstream effectors might enhance anti-tumor immune responses

• Male infertility: Understanding the mechanisms by which DNALI1 contributes to sperm development could inform diagnostic approaches for unexplained male infertility cases and potentially guide development of assisted reproductive technologies

• Biomarker development: DNALI1 expression levels show promise as prognostic biomarkers in cancer contexts, particularly LGG where receiver operating characteristic (ROC) curves demonstrated reliable prognostic value (1-year AUC 0.724, 3-year AUC 0.684, 5-year AUC 0.648)

Future research should focus on clarifying the mechanistic relationships between DNALI1 expression/function and disease progression to identify the most promising intervention points.