EDA2R Human, Sf9

What is EDA2R Human, Sf9 and what are its key structural features?

EDA2R Human produced in Sf9 Baculovirus cells is a recombinant glycosylated polypeptide containing 380 amino acids (1-138 a.a.) with a molecular mass of approximately 42.5kDa. When visualized on SDS-PAGE, it typically appears at 40-57kDa due to post-translational modifications. The protein is expressed with a 242 amino acid hIgG-His tag at the C-terminus and is purified using proprietary chromatographic techniques. Structurally, EDA2R is a type III transmembrane protein belonging to the tumor necrosis factor receptor (TNFR) superfamily, featuring 3 cysteine-rich repeats and a single transmembrane domain, but notably lacking an N-terminal signal peptide .

What are the known signaling pathways activated by EDA2R?

EDA2R primarily mediates the activation of the NF-κB and JNK pathways. This activation appears to be facilitated through binding to TRAF3 and TRAF6 adaptor proteins. Research demonstrates that EDA2R's role in these signaling cascades has significant implications for cellular processes including apoptosis and inflammatory responses. In myocardial ischemia/reperfusion models, EDA2R knockdown has been shown to inactivate the NF-κB signaling pathway, suggesting this pathway is central to its biological function. Methodologically, researchers can assess EDA2R-mediated pathway activation by measuring phosphorylation of IκBα and p65, key components of the NF-κB pathway .

How does EDA2R differ from EDAR (Ectodysplasin A Receptor)?

While both belonging to the tumor necrosis factor receptor family, EDA2R and EDAR have distinct ligand specificities and biological functions:

Methodologically, researchers must ensure precise antibody specificity when studying either receptor to avoid cross-reactivity and misattribution of experimental results .

What are the optimal storage and handling conditions for EDA2R Human, Sf9?

For optimal stability and activity preservation of EDA2R Human Sf9 protein:

• Store the protein solution (0.5mg/ml) in phosphate-buffered saline (pH 7.4) containing 20% glycerol and 1mM DTT.

• For long-term storage, add a carrier protein (0.1% HSA or BSA) to maintain stability.

• Avoid repeated freeze-thaw cycles that can lead to protein denaturation and loss of activity.

• When aliquoting for experiments, maintain sterile conditions and use low-protein binding tubes.

• Prior to functional assays, allow the protein to equilibrate to room temperature gradually.

These storage guidelines are critical for maintaining consistent experimental results across longitudinal studies. Researchers should validate protein activity after extended storage periods using functional assays that assess NF-κB pathway activation .

How can researchers effectively design knockdown experiments to study EDA2R function?

Designing effective EDA2R knockdown experiments requires careful consideration of several methodological aspects:

• Vector Selection: Use appropriate vectors for the cellular context. For in vivo studies, adeno-associated virus 9 (AAV9) has been successfully used to deliver shRNA targeting EDA2R in myocardial I/R models.

• shRNA Design: The validated shRNA sequence targeting EDA2R is: CCGGGATTGTGGTTATGGAGAAGGTTCAAGAGACCTTCTCCATAACCACAATCCTTTTTT. Design control shRNAs with scrambled sequences of similar length and GC content.

• Validation Methods: Confirm knockdown efficiency using:

  • Western blot analysis with specific EDA2R antibodies (1:5,000; ab167224; Abcam)

  • qRT-PCR for mRNA expression levels

  • Functional assays measuring downstream effectors of NF-κB pathway

• Timing Considerations: For in vivo models, administer the AAV9-shEDA2R approximately 10 days before experimental procedures to achieve optimal knockdown.

• Readout Measurements: After knockdown, assess relevant parameters including cell viability, apoptosis markers, mitochondrial membrane potential, and oxidative stress indicators to comprehensively evaluate EDA2R function .

What functional assays can be used to evaluate EDA2R activity in experimental systems?

To evaluate EDA2R activity comprehensively, researchers should employ a combination of functional assays:

• Cell Viability and Apoptosis Assessment:

  • MTT/CCK-8 assays to measure cell viability

  • Flow cytometry with Annexin V/PI staining to quantify apoptotic cells

  • TUNEL assay for tissue sections to visualize apoptotic cells in situ

• Mitochondrial Function:

  • JC-1 staining to evaluate mitochondrial membrane potential

  • Western blot analysis of Cytochrome C release from mitochondria to cytosol

  • Measurement of mitochondrial respiratory chain complex activities

• Apoptotic Pathway Analysis:

  • Western blot for key proteins: Bcl-2 (anti-apoptotic), Bax (pro-apoptotic)

  • Colorimetric assays for Caspase-3 and Caspase-9 activities

  • Immunoprecipitation to detect protein-protein interactions with TRAF3 and TRAF6

• Oxidative Stress Evaluation:

  • Measurement of reactive oxygen species (ROS) levels

  • Quantification of malondialdehyde (MDA) content

  • Evaluation of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities

• NF-κB Pathway Activation:

  • Western blot analysis of phosphorylated IκBα and p65

  • Electrophoretic mobility shift assay (EMSA) to assess NF-κB DNA binding

  • Luciferase reporter assay using NF-κB responsive elements .

How does EDA2R expression influence myocardial ischemia/reperfusion injury outcomes?

EDA2R plays a significant role in myocardial ischemia/reperfusion (I/R) injury through multiple mechanistic pathways:

• Apoptotic Regulation: EDA2R knockdown significantly reduces cardiomyocyte apoptosis during I/R injury. This anti-apoptotic effect occurs through multiple mechanisms:

  • Elevated mitochondrial membrane potential preservation

  • Inhibition of Cytochrome C release from mitochondria

  • Upregulation of anti-apoptotic Bcl-2 expression

  • Downregulation of pro-apoptotic Bax expression

  • Decreased activity of Caspase-3 and Caspase-9

• Oxidative Stress Modulation: EDA2R silencing suppresses I/R-induced oxidative stress in myocardial tissue, as evidenced by:

  • Reduced reactive oxygen species generation

  • Decreased oxidative damage markers

  • Enhanced antioxidant enzyme activities

• NF-κB Pathway Inhibition: Mechanistically, EDA2R knockdown inactivates the NF-κB signaling pathway, which is a central mediator of inflammatory responses during I/R injury.

• Functional Improvement: In mouse models, EDA2R downregulation improves left ventricular function following I/R injury, with measurable improvements in:

  • Left ventricular ejection fraction (LVEF)

  • Left ventricular fractional shortening (LVFS)

  • Reduced infarct size

These findings suggest that targeting EDA2R expression could be a potential therapeutic strategy for mitigating myocardial I/R injury. Researchers investigating this pathway should incorporate comprehensive cardiac functional assessments, including echocardiography, to correlate molecular changes with physiological outcomes .

What are the challenges in distinguishing EDA2R-specific effects from other TNF receptor family members in experimental systems?

Researchers face several methodological challenges when attempting to isolate EDA2R-specific effects:

• Structural Homology: The TNF receptor superfamily shares structural similarities, particularly in the cysteine-rich domains, potentially leading to cross-reactivity of antibodies and other detection reagents.

• Pathway Redundancy: Multiple TNF receptor family members activate overlapping downstream pathways, including NF-κB and JNK, making it difficult to attribute observed effects solely to EDA2R.

• Technical Approaches to Overcome These Challenges:

  • Use highly specific antibodies validated against multiple TNF receptor family members

  • Implement combinatorial knockdown/overexpression experiments to delineate specific contributions

  • Employ receptor-specific ligands (e.g., EDA-A2 specifically binds EDA2R)

  • Conduct comprehensive receptor expression profiling in experimental systems

  • Utilize CRISPR/Cas9-mediated knockout models with subsequent rescue experiments

• Data Interpretation Considerations:

  • Control for compensatory upregulation of other family members following EDA2R manipulation

  • Validate findings across multiple cell types and experimental models

  • Use ligand-specific stimulation alongside pathway-specific inhibitors to dissect unique contributions

Through these methodological refinements, researchers can more confidently attribute observed phenotypes specifically to EDA2R rather than to general TNF receptor signaling pathways .

How can researchers investigate the interaction between EDA2R and the dexmedetomidine (DEX) protective effect in cardiac models?

Investigating the relationship between EDA2R and dexmedetomidine's cardioprotective effects requires a systematic experimental approach:

• Expression Analysis:

  • Quantify EDA2R expression changes following DEX treatment in dose-response and time-course experiments

  • Analyze both mRNA (qRT-PCR) and protein levels (Western blot) to determine transcriptional vs. post-transcriptional regulation

• Mechanistic Investigation:

  • Determine if DEX directly binds to EDA2R using:

    • Surface plasmon resonance (SPR)

    • Isothermal titration calorimetry (ITC)

    • Co-immunoprecipitation assays

  • Investigate if DEX effects are mediated through α2-adrenergic receptors using specific antagonists (e.g., yohimbine)

  • Assess if DEX affects EDA2R-mediated NF-κB pathway activation through reporter assays

• Functional Studies:

  • Compare DEX effects in wild-type vs. EDA2R-knockdown cardiomyocytes

  • Design rescue experiments by overexpressing EDA2R in DEX-treated cells

  • Examine if EDA2R knockdown and DEX have additive or synergistic effects on cardioprotection

• In Vivo Validation:

  • Develop mouse models with conditional cardiomyocyte-specific EDA2R knockout

  • Compare DEX effects in wild-type vs. EDA2R knockout mice subjected to I/R injury

  • Measure comprehensive cardiac function parameters (LVEF, LVFS, infarct size)

  • Assess molecular markers of apoptosis and oxidative stress in cardiac tissue

• Clinical Correlation:

  • Analyze EDA2R expression in human cardiac tissue samples from patients with ischemic heart disease

  • Correlate EDA2R levels with clinical outcomes in patients receiving DEX during cardiac procedures

This integrated approach would help delineate whether EDA2R downregulation is a critical mechanism underlying DEX's protective effects against myocardial I/R injury .

What is the significance of EDA2R glycosylation patterns in Sf9-expressed protein compared to mammalian systems?

The glycosylation profile of EDA2R in Sf9 insect cells differs notably from mammalian expression systems, with important research implications:

• Glycosylation Differences:

  • Sf9 cells produce primarily high-mannose, paucimannose, and non-fucosylated N-glycans

  • Mammalian cells generate complex N-glycans with terminal sialic acids and core fucosylation

  • O-glycosylation patterns also differ significantly between systems

• Functional Consequences:

  • Receptor-ligand binding kinetics may be altered due to glycosylation differences

  • Protein stability and half-life can vary between insect and mammalian-expressed proteins

  • Immunogenicity profiles differ, potentially affecting in vivo applications

• Experimental Considerations:

  • Researchers should verify if glycosylation affects EDA2R's binding to EDA-A2 using surface plasmon resonance

  • Comparative studies using both Sf9 and mammalian-expressed proteins are recommended for critical experiments

  • Enzymatic deglycosylation experiments can help determine if glycosylation impacts functional properties

• Analytical Methods:

  • High-resolution mass spectrometry to characterize glycan structures

  • Lectin binding assays to profile glycosylation patterns

  • Site-directed mutagenesis of putative glycosylation sites to assess their functional importance

Understanding these differences is crucial when extrapolating in vitro findings to mammalian systems or designing therapeutic approaches targeting EDA2R .

How do alternatively spliced variants of EDA2R impact experimental design and data interpretation?

Alternatively spliced variants of EDA2R present significant challenges and considerations for experimental design:

• Known Variants and Their Differences:

  • Multiple alternatively spliced transcripts have been identified for the EDA2R gene

  • These variants may differ in domain structure, ligand binding properties, or downstream signaling capabilities

  • Some variants may lack specific functional domains or exhibit dominant-negative effects

• Experimental Design Considerations:

  • Primer/probe design for qRT-PCR should account for variant-specific regions

  • Western blot interpretation requires careful consideration of expected molecular weights

  • Antibody selection should ensure recognition of relevant variants or be specific to certain variants

  • Cloning strategies for overexpression studies should clearly specify which variant is being utilized

• Functional Impact Assessment:

  • Compare signaling properties of different variants using reporter assays

  • Evaluate differential protein-protein interactions among variants

  • Assess tissue-specific expression patterns of various splice variants

  • Determine if certain variants are preferentially upregulated under specific pathological conditions

• Data Interpretation Framework:

  • Clearly report which variant(s) are being studied in publications

  • Consider if observed phenotypes might be due to shifts in variant expression ratios

  • Validate key findings across multiple cell types that may express different variant profiles

  • When using knockdown approaches, evaluate if all relevant variants are effectively targeted

This comprehensive approach to addressing splice variant complexity will enhance experimental rigor and improve the reproducibility of EDA2R research findings .

What potential therapeutic applications emerge from understanding EDA2R's role in myocardial ischemia/reperfusion injury?

Research on EDA2R in myocardial I/R injury reveals several promising therapeutic directions:

• Gene Therapy Approaches:

  • Adeno-associated virus (AAV)-mediated delivery of EDA2R shRNA has shown efficacy in mouse models

  • Development of cardiomyocyte-specific promoters could enhance targeting precision

  • Optimization of delivery timing relative to anticipated ischemic events requires further investigation

• Small Molecule Inhibitors:

  • Structure-based drug design targeting the EDA2R-ligand binding interface

  • Allosteric modulators affecting EDA2R's ability to activate downstream signaling

  • Screening compounds that disrupt EDA2R interactions with TRAF3/TRAF6 adaptor proteins

• Combination Therapies:

  • Co-administration of EDA2R inhibitors with established cardioprotective agents like dexmedetomidine

  • Targeting multiple points in the NF-κB pathway to enhance anti-inflammatory effects

  • Combining EDA2R modulation with antioxidant approaches for synergistic benefit

• Biomarker Development:

  • Evaluation of circulating EDA2R levels as predictive biomarkers for I/R injury susceptibility

  • Monitoring EDA2R expression patterns to guide personalized therapeutic approaches

  • Developing imaging agents targeting EDA2R to visualize affected myocardial regions

• Methodological Considerations for Therapeutic Development:

  • Establishment of humanized mouse models expressing human EDA2R variants

  • Development of cardiac-specific conditional knockout models for precise temporal studies

  • Implementation of patient-derived cardiomyocytes to validate findings in human-relevant systems

These therapeutic directions highlight the translational potential of basic research findings on EDA2R in myocardial I/R injury, while emphasizing the importance of rigorous preclinical validation .

What are the critical quality control parameters when working with recombinant EDA2R Human, Sf9?

Researchers should implement comprehensive quality control measures for EDA2R Human, Sf9:

• Purity Assessment:

  • SDS-PAGE analysis with Coomassie or silver staining (expected purity >90%)

  • Size exclusion chromatography to detect aggregates

  • Mass spectrometry to confirm protein identity and evaluate modifications

• Functional Validation:

  • Binding affinity measurements using surface plasmon resonance with purified EDA-A2 ligand

  • Confirmation of NF-κB pathway activation in responsive cell lines

  • Verification of co-immunoprecipitation with known binding partners (TRAF3, TRAF6)

• Stability Monitoring:

  • Differential scanning fluorimetry to assess thermal stability

  • Activity assays before and after storage under recommended conditions

  • Accelerated stability studies to predict long-term storage viability

• Post-translational Modification Analysis:

  • Glycosylation profiling using lectin blots or mass spectrometry

  • Phosphorylation state assessment using phospho-specific antibodies

  • Verification of correct disulfide bond formation, particularly in cysteine-rich domains

• Contaminant Testing:

  • Endotoxin testing using Limulus Amebocyte Lysate assay (<1 EU/mg protein)

  • Host cell protein quantification using ELISA

  • Residual DNA quantification (<10 ng/mg protein)

How should researchers design experiments to resolve contradictory findings regarding EDA2R's role in different cell types?

When addressing contradictory findings about EDA2R function across different cell types:

• Systematic Cell Type Comparison:

  • Design experiments using multiple cell types simultaneously under identical conditions

  • Include primary cells, established cell lines, and patient-derived cells when possible

  • Characterize baseline EDA2R expression and signaling components in each cell type

• Context-Dependent Signaling Analysis:

  • Evaluate EDA2R interactome using proximity labeling approaches (BioID, APEX) in different cell types

  • Assess phosphoproteomic profiles following EDA2R activation to identify divergent signaling

  • Map EDA2R-dependent transcriptional networks using RNA-seq or ChIP-seq for NF-κB binding sites

• Genetic Background Considerations:

  • Generate isogenic cell lines with defined EDA2R expression levels

  • Use CRISPR-based screening to identify genetic modifiers of EDA2R function

  • Consider single-cell analyses to detect heterogeneous responses within populations

• Experimental Design Principles:

  • Employ dose-response studies across cell types to identify threshold effects

  • Include appropriate positive and negative controls for each cell type

  • Utilize multiple, complementary methodologies to validate key findings

  • Conduct time-course experiments to capture kinetic differences in response

• Collaborative Validation Approach:

  • Implement standardized protocols across different laboratories

  • Share key reagents (antibodies, constructs, cell lines) to eliminate technical variables

  • Perform blinded analyses of critical outcome measures

This structured approach helps distinguish genuine biological differences from technical artifacts, ultimately resolving conflicting findings in the literature .

What advanced proteomics approaches can reveal novel insights about EDA2R interaction networks?

Cutting-edge proteomics strategies can illuminate EDA2R's complex interaction landscape:

• Proximity-Based Interactome Mapping:

  • BioID or TurboID fusion proteins to identify proteins in close proximity to EDA2R

  • APEX2-based proximity labeling for temporal resolution of dynamic interactions

  • Split-BioID approaches to study compartment-specific interactions

• Crosslinking Mass Spectrometry (XL-MS):

  • Chemical crosslinking combined with MS to capture direct protein-protein interactions

  • Identification of specific binding interfaces through residue-level resolution

  • Implementation of MS-cleavable crosslinkers for improved identification rates

• Thermal Proximity Coaggregation (TPCA):

  • Detect protein-protein interactions based on co-aggregation behaviors

  • Map changes in the EDA2R interactome under different cellular conditions

  • Identify weak or transient interactions often missed by traditional methods

• Hydrogen-Deuterium Exchange MS (HDX-MS):

  • Characterize conformational changes upon ligand binding or protein-protein interactions

  • Map interaction interfaces with higher structural resolution

  • Detect allosteric effects induced by binding partners

• Integrative Computational Analysis:

  • Network analysis incorporating interaction confidence scores

  • Pathway enrichment to identify biological processes affected by EDA2R

  • Structural modeling of interaction interfaces for drug design applications

  • Dynamic visualization of temporal interaction changes under various stimuli

These advanced approaches can identify novel regulatory mechanisms, uncover unexpected interaction partners, and provide a systems-level understanding of EDA2R function in health and disease contexts .

What are the most promising research directions for EDA2R Human, Sf9 in cardiovascular research?

Based on current evidence, several high-priority research directions emerge:

• Translational Cardiovascular Applications:

  • Development of EDA2R-targeted interventions for myocardial protection during planned ischemic events (bypass surgery, transplantation)

  • Investigation of EDA2R as a biomarker for risk stratification in patients with ischemic heart disease

  • Exploration of EDA2R modulation as a complementary approach to conventional cardioprotective strategies

• Mechanistic Investigations:

  • Detailed characterization of EDA2R-mediated mitochondrial dysfunction in cardiomyocytes

  • Elucidation of cross-talk between EDA2R and other death receptors in the context of cardiac injury

  • Investigation of cell type-specific effects within the heterogeneous cardiac tissue environment

• Methodological Innovations:

  • Development of selective EDA2R antagonists or blocking antibodies for research and therapeutic applications

  • Creation of improved reporter systems for real-time monitoring of EDA2R activation in living cells and tissues

  • Generation of EDA2R conditional knockout mouse models for temporal control of receptor ablation

The intersection of EDA2R biology with cardiovascular pathophysiology represents a promising area for discovery, with potential implications for developing novel therapeutic strategies for ischemic heart disease .

How can researchers effectively integrate in vitro findings on EDA2R Human, Sf9 with in vivo disease models?

Bridging the gap between in vitro and in vivo EDA2R research requires systematic methodological approaches:

• Stepwise Translation Strategy:

  • Begin with well-controlled in vitro studies using purified EDA2R (Sf9) to establish direct effects

  • Progress to cellular models with increasing complexity (monocultures → co-cultures → 3D organoids)

  • Advance to ex vivo systems (isolated perfused hearts) before full in vivo studies

  • Validate findings across multiple species (mouse → larger mammals → human samples)

• Correlative Analysis Framework:

  • Establish clear, quantifiable readouts that can be measured across in vitro and in vivo systems

  • Develop pharmacokinetic/pharmacodynamic (PK/PD) models relating EDA2R modulation to functional outcomes

  • Implement consistent sampling timepoints to facilitate direct comparisons

  • Use identical analytical methods when possible to minimize technical variation

• Technological Integration:

  • Employ intravital imaging to visualize EDA2R-dependent processes in living animals

  • Utilize tissue-clearing techniques combined with 3D imaging for whole-organ analysis

  • Implement single-cell transcriptomics to map cellular heterogeneity in responses

  • Apply spatial transcriptomics/proteomics to preserve tissue context information

• Validation Checkpoints:

  • Confirm that in vivo EDA2R expression patterns match the systems being modeled in vitro

  • Verify that key signaling events observed in vitro occur with similar kinetics in vivo

  • Validate that pharmacological tools exhibit comparable specificity across systems

  • Assess whether compensatory mechanisms present in vivo are accounted for in simpler models

This integrated approach strengthens the translational relevance of EDA2R research findings and increases the likelihood of successful therapeutic development .

What methodological advances are needed to address remaining questions about EDA2R function and therapeutic potential?

Several methodological innovations would significantly advance EDA2R research:

• Structural Biology Approaches:

  • High-resolution crystal or cryo-EM structures of EDA2R alone and in complex with ligands

  • Structural characterization of EDA2R transmembrane domain in native lipid environments

  • NMR studies of conformational dynamics during receptor activation

• Genetic Tool Development:

  • Inducible, cell type-specific EDA2R knockout/knockin models

  • CRISPR activation/inhibition systems targeting EDA2R with temporal control

  • Humanized mouse models expressing human EDA2R variants for translational studies

• Advanced Imaging Methodologies:

  • Super-resolution microscopy techniques to visualize EDA2R clustering and trafficking

  • FRET/BRET biosensors to monitor EDA2R activation in real-time

  • Multiplexed imaging approaches to simultaneously track multiple signaling events

• Pharmaceutical Development:

  • Structure-based design of selective EDA2R modulators (agonists/antagonists)

  • Development of proteolysis-targeting chimeras (PROTACs) for targeted EDA2R degradation

  • Creation of bispecific antibodies targeting EDA2R and complementary pathways

• Systems Biology Integration:

  • Multi-omics approaches combining transcriptomics, proteomics, and metabolomics

  • Machine learning algorithms to identify patterns in complex EDA2R-dependent datasets

  • Computational modeling of EDA2R signaling networks with predictive capabilities