ENTPD6 Mouse

What is ENTPD6 and where is it located in the mouse genome?

ENTPD6, also known as CD39L2, is an ectonucleoside triphosphate diphosphohydrolase that is encoded in the mouse genome. It is specifically located on chromosome 2 of mice . The gene encodes a protein that functions as an enzyme involved in nucleotide metabolism. In mouse models, ENTPD6 is studied for its potential roles in various physiological and pathological processes, often through conditional knockout approaches that enable tissue-specific investigation of its function .

What are the available ENTPD6 mouse models and how are they generated?

Several ENTPD6 mouse models have been developed, with conditional knockout mice being particularly valuable for research. These models are typically generated using CRISPR/Cas technology, where sgRNA and ssDNA are designed to target the Entpd6 gene . One specific example is the conditional knockout model with the allele designation Entpd6tm1a(KOMP)Wtsi, which is a "Knockout First, Reporter-tagged insertion with conditional potential" type . This model was created through the International Knockout Mouse Consortium (IKMC) and is available through repositories such as the Wellcome Sanger Institute . The generation process typically involves high-throughput electroporation of fertilized eggs followed by sperm collection for cryopreservation after the mice reach sexual maturity .

How do I genotype ENTPD6 mouse models?

Genotyping ENTPD6 mouse models requires a combination of PCR reactions to determine the presence of wild-type and mutant alleles. According to established protocols, three standard PCR reactions are recommended:

The specific primer sequences are:

• Entpd6_35296_F: CCACTCCTCCGAACATCAAAC

• Entpd6_35296_R: AGAGCAGACAACTCACACCCTAAC

• CAS_R1_Term: TCGTGGTATCGTTATGCGCC

• LacZ_2_small_F: ATCACGACGCGCTGTATC

• LacZ_2_small_R: ACATCGGGCAAATAATATCG

The PCR reaction should use standard amplification conditions with an annealing temperature of 58°C . The genotype is determined by interpreting the consolidated results from these reactions. For example, a heterozygous mouse would be positive for the cassette, mutant, and wild-type bands .

What are the key protein characteristics of mouse ENTPD6?

Mouse ENTPD6 (UniProt ID: Q3U0P5) is characterized as follows:

Post-translational modifications identified for ENTPD6 include ubiquitination at K3 and phosphorylation at Y262, as reported in PhosphoSitePlus .

How do I design experiments to assess the functional impact of ENTPD6 conditional knockout in specific tissues?

When designing experiments to evaluate tissue-specific effects of ENTPD6 deletion, researchers should employ a systematic approach that combines molecular validation with functional assessments. Begin by confirming the conditional knockout efficiency using tissue-specific PCR genotyping and protein expression analysis (western blotting or immunohistochemistry). For tissue-specific deletion, the Entpd6tm1a(KOMP)Wtsi conditional allele can be converted to functional knockout using tissue-specific Cre recombinase expression .

The experimental design should include:

• Molecular validation: Confirm deletion efficiency at DNA (PCR), RNA (qRT-PCR), and protein levels (western blot/immunohistochemistry).

• Physiological assessments: Based on the tissue targeted, include relevant functional tests. For neurological studies, consider behavioral assays; for metabolic tissues, include glucose tolerance tests; for immunological studies, incorporate cell population analysis and functional immune assays.

• Control groups: Include both Cre-negative floxed mice and wild-type controls to distinguish between Cre-mediated effects and ENTPD6 deletion effects.

• Temporal considerations: For inducible systems, establish appropriate timepoints post-induction to capture both immediate and long-term consequences of ENTPD6 deletion.

Remember that rapid conversion of the conditional alleles can be achieved using cell-permeable Cre recombinase as described by Ryder et al. (2013) , which may be advantageous for certain experimental designs.

What are the known phenotypes associated with ENTPD6 deficiency in mice and how can contradictory findings be resolved?

Currently, comprehensive phenotypic characterization of ENTPD6-deficient mice appears limited in the available literature . The datasheet from the Wellcome Sanger Institute indicates that phenotypic data should be available through the International Mouse Phenotyping Consortium (IMPC), but specific phenotypes are not directly listed in the search results .

To address contradictory findings that may emerge in ENTPD6 research:

• Genetic background considerations: Carefully document the exact strain background (e.g., C57BL/6JCya or C57BL/6N) as genetic background can significantly influence phenotypes . The EUCOMM/KOMP-CSD ES cell resources typically use C57BL/6N embryonic stem cells as described by Pettitt et al. (2009) .

• Age and sex considerations: Stratify analyses by age and sex, as ENTPD6-related phenotypes may exhibit age or sex-specific manifestations.

• Environmental factors: Standardize housing conditions, diet, and microbiome status across experimental cohorts.

• Molecular mechanism analysis: When contradictory phenotypes are observed, conduct in-depth molecular analyses to identify potential compensatory mechanisms or strain-specific modifiers.

• Cross-validation approach: Employ multiple experimental approaches and models (e.g., comparing conditional knockout with siRNA knockdown or pharmacological inhibition) to validate observed phenotypes.

When contradictory findings emerge, a systematic meta-analysis approach comparing experimental conditions, genetic backgrounds, and methodological differences can help resolve discrepancies.

How can I optimize CRISPR/Cas9-mediated generation of ENTPD6 mouse models beyond the standard protocols?

Optimizing CRISPR/Cas9-mediated generation of ENTPD6 mouse models requires several advanced considerations beyond standard protocols:

• Enhanced sgRNA design:

  • Utilize multiple prediction algorithms to select sgRNAs with minimal off-target effects

  • Design sgRNAs targeting conserved functional domains of ENTPD6

  • Include sgRNA efficiency validation in mouse cell lines before in vivo application

• Delivery optimization:

  • Compare high-throughput electroporation (as mentioned in the search results ) with microinjection

  • Test different Cas9 formats (protein, mRNA, or ribonucleoprotein complexes)

  • Consider timing of delivery (one-cell versus two-cell stage embryos)

• Homology-directed repair (HDR) enhancement:

  • For precise mutations or insertions, include small molecule HDR enhancers (e.g., RS-1, SCR7)

  • Optimize homology arm length for specific modifications

  • Consider asymmetric donor design for improved HDR efficiency

• Screening strategies:

  • Implement high-throughput genotyping workflows

  • Utilize droplet digital PCR for more sensitive detection of editing events

  • Consider next-generation sequencing for comprehensive assessment of on-target and potential off-target modifications

• Mosaic reduction strategies:

  • Deliver editing components earlier in development

  • Consider maternal expression of Cas9 followed by zygotic sgRNA delivery

  • Implement strategies that select for non-mosaic founder animals

These optimizations can significantly improve the efficiency and precision of generating ENTPD6 mouse models, particularly when complex modifications are required.

What are the best experimental approaches to study ENTPD6 enzymatic activity in different mouse tissues?

Studying ENTPD6 enzymatic activity in mouse tissues requires specialized approaches due to its role as an ectonucleoside triphosphate diphosphohydrolase. The following methodological framework is recommended:

• Tissue preparation optimization:

  • Fresh tissue collection in appropriate buffers that preserve enzymatic activity

  • Subcellular fractionation to isolate relevant membrane compartments where ENTPD6 is active

  • Careful temperature control throughout processing

• Activity assays:

  • Colorimetric phosphate release assays using nucleotide substrates (ATP, ADP)

  • HPLC-based methods to detect substrate consumption and product formation

  • Real-time monitoring of enzymatic activity using fluorescent or bioluminescent reporters

• Substrate specificity analysis:

  • Comparative analysis of different nucleotides as substrates

  • Kinetic parameter determination (Km, Vmax) for different tissues

  • Competition assays to determine substrate preferences

• Inhibitor studies:

  • Use of specific inhibitors to validate assay specificity

  • Dose-response relationships in different tissues

  • Inhibitor competition studies to characterize binding sites

• In situ activity visualization:

  • Enzyme histochemistry using lead phosphate precipitation methods

  • Fluorescent substrate analogues for live tissue imaging

  • Correlation of activity with protein localization using immunohistochemistry

It's essential to include appropriate controls, particularly tissues from ENTPD6 knockout mice, to differentiate ENTPD6-specific activity from other ectonucleotidases that may have overlapping substrate preferences.

How can I effectively convert between different ENTPD6 conditional allele variants?

Converting between different ENTPD6 conditional allele variants requires specific recombinase-mediated strategies. The Entpd6tm1a(KOMP)Wtsi allele, described in the search results, is a "Knockout First, Reporter-tagged insertion with conditional potential" that can be converted to other functional variants . For effective conversion:

• tm1a to tm1c (conditional ready) conversion:

  • Use Flp recombinase to remove the FRT-flanked cassette

  • This maintains the loxP-flanked critical exon while removing the reporter and selection elements

  • Can be accomplished by crossing with Flp-expressing mice (e.g., FLPeR mice described by Farley et al., 2000)

  • Alternatively, cell-permeable Flp protein can be used in early embryos

• tm1a to tm1b (lacZ-tagged null) conversion:

  • Use Cre recombinase to remove the loxP-flanked critical exon

  • Maintains the lacZ reporter for expression mapping

  • Can be accomplished by crossing with ubiquitous Cre-expressing mice

  • Results in a constitutive knockout with reporter expression

• tm1c to tm1d (conditional knockout) conversion:

  • tm1c mice are crossed with tissue-specific Cre-expressing lines

  • Results in tissue-specific deletion of the critical exon

  • Rapid conversion using cell-permeable Cre as described by Ryder et al. (2013)

For validation of conversion, specific PCR strategies are required for each allele type. The EUCOMM/KOMP resource provides detailed genotyping guides for distinguishing between these allele variants, with specific primers and protocols available through the International Mouse Phenotyping Consortium (IMPC) website .

What are the best practices for maintaining ENTPD6 mouse colonies and managing genetic drift?

Maintaining ENTPD6 mouse colonies while minimizing genetic drift requires structured breeding strategies and regular quality control. Based on established practices for genetically modified mouse lines:

• Breeding strategy implementation:

  • Establish a hierarchical breeding structure with dedicated breeders separated from experimental cohorts

  • Implement rotational breeding schemes to maintain genetic diversity

  • Regularly backcross to the original background strain (e.g., C57BL/6N for EUCOMM/KOMP-derived lines)

  • Maintain heterozygotes as breeding stock when homozygotes have reduced fertility

• Cryopreservation program:

  • Establish cryopreserved stocks of sperm and/or embryos from early generations

  • As mentioned in the search results, sperm cryopreservation is performed after sexual maturity for ENTPD6 mouse models

  • Periodically refresh cryopreserved stocks to capture current colony status

  • Maintain detailed records of cryopreserved material, including generation number and genetic background

• Quality control monitoring:

  • Implement regular genotyping protocols using the established PCR methods

  • Periodically validate allele integrity using long-range PCR or sequencing

  • Monitor for the presence of genetic contaminants or spontaneous mutations

  • Document colony health parameters and breeding performance

• Genetic background considerations:

  • Be aware of subtle differences between C57BL/6 substrains (e.g., C57BL/6J vs. C57BL/6N)

  • The ENTPD6 mouse model described is on C57BL/6JCya background or C57BL/6N (EUCOMM/KOMP)

  • Note that genomic copy number variations have been documented in embryonic stem cells as reported by Liang et al. (2008)

  • Consider the potential impact of a spontaneous albinism observed in some C57BL/6N strains (Ryder et al., 2013)

These practices will help maintain colony integrity and ensure experimental reproducibility across generations.

How can I integrate ENTPD6 mouse models with other genetic models for complex experimental designs?

Integrating ENTPD6 mouse models with other genetic models requires careful planning and strategic breeding approaches:

• Breeding strategy design:

  • Map out the required crossings to achieve desired genotypes

  • Calculate the expected genotype frequencies at each generation

  • Plan breeding schemes that minimize the number of generations to achieve experimental cohorts

  • Consider whether sequential or parallel crossing strategies are more efficient

• Compound mutant validation:

  • Develop multiplexed genotyping protocols that can simultaneously detect all relevant alleles

  • Confirm that multiple genetic modifications don't interfere with each other's expression or function

  • Validate that phenotypes in compound mutants represent true genetic interactions rather than additive effects

  • Check for unexpected recombination events between loci

• Background strain harmonization:

  • Ensure all models are on the same genetic background or backcross to achieve uniformity

  • Be particularly careful with mixing C57BL/6 substrains, as the ENTPD6 models may be on C57BL/6JCya or C57BL/6N

  • Document the generation number and background strain percentage of all models

  • Consider using marker-assisted selection to accelerate background harmonization

• Inducible system integration:

  • For temporal control, incorporate inducible systems (e.g., tetracycline-responsive or tamoxifen-inducible)

  • Validate that the ENTPD6 conditional allele is compatible with chosen inducible systems

  • Develop protocols for sequential activation of different genetic modifications

  • Optimize inducer dosing to achieve desired recombination efficiency

• Experimental controls:

  • Generate all possible genetic combinations as controls

  • Include single-transgenic/single-mutant controls alongside compound mutants

  • Consider the impact of Cre or other recombinases alone on phenotypes

  • Maintain wild-type controls from the same colony for comparative analyses

This structured approach will facilitate the development of complex genetic models incorporating ENTPD6 modifications while maintaining experimental rigor.

What are the emerging applications of ENTPD6 mouse models in understanding nucleotide metabolism and signaling?

ENTPD6 mouse models offer powerful tools for investigating nucleotide metabolism and signaling pathways. While the search results don't detail specific applications, the following represent key research directions based on the function of ENTPD6 as an ectonucleoside triphosphate diphosphohydrolase:

• Purinergic signaling investigation:

  • Tissue-specific deletion of ENTPD6 can reveal compartmentalized roles in regulating extracellular ATP/ADP levels

  • Analysis of downstream purinergic receptor activation patterns in conditional knockout models

  • Integration with other ectonucleotidase knockouts to map nucleotide degradation pathways

• Metabolic regulation studies:

  • Investigation of ENTPD6's role in cellular energy homeostasis

  • Analysis of interactions between nucleotide metabolism and other metabolic pathways

  • Potential roles in metabolic diseases through altered nucleotide availability

• Immune regulation applications:

  • Given that CD39 family members regulate immune functions through ATP/adenosine modulation

  • Investigation of ENTPD6 in immune cell development and function

  • Potential applications in understanding inflammatory diseases

• Developmental biology:

  • Analysis of ENTPD6's role during embryonic development

  • Tissue-specific requirements for nucleotide metabolism during organogenesis

  • Potential developmental timing mechanisms regulated by extracellular nucleotides

• Pathophysiological models:

  • Integration of ENTPD6 conditional knockout with disease models to assess therapeutic potential

  • Investigation of ENTPD6 as a target in cancer, inflammation, and metabolic disorders

  • Comparative analysis with human ENTPD6-associated conditions

These applications represent promising research directions that leverage the flexibility of conditional ENTPD6 mouse models to address fundamental questions in nucleotide biology and disease mechanisms.

How can single-cell approaches be integrated with ENTPD6 mouse models to advance our understanding?

Integrating single-cell approaches with ENTPD6 mouse models can provide unprecedented insights into cell-specific functions and heterogeneity:

• Single-cell transcriptomics applications:

  • Compare transcriptional profiles between wild-type and ENTPD6-deficient cells within tissues

  • Identify cell populations most affected by ENTPD6 deletion

  • Map compensatory transcriptional networks activated in response to ENTPD6 deficiency

  • Track developmental trajectories altered by ENTPD6 deletion in lineage-tracing studies

• Single-cell proteomics integration:

  • Analyze proteome changes at single-cell resolution in ENTPD6-deficient tissues

  • Identify cell-specific post-translational modifications affected by altered nucleotide metabolism

  • Correlate protein expression patterns with enzymatic activity measurements

• Spatial transcriptomics/proteomics approaches:

  • Map ENTPD6 expression patterns with spatial resolution in tissues

  • Correlate spatial expression with functional outcomes in conditional knockout models

  • Identify neighborhood effects where ENTPD6-expressing cells influence adjacent cell populations

• Functional single-cell assays:

  • Develop microfluidic approaches to measure ENTPD6 activity in individual cells

  • Implement single-cell calcium imaging to assess purinergic signaling responses

  • Correlate metabolic profiles with ENTPD6 activity at single-cell resolution

• Computational integration frameworks:

  • Develop multi-omics integration methods specific to nucleotide metabolism

  • Create cell-cell communication maps based on purinergic signaling networks

  • Model the impact of ENTPD6 deletion on tissue microenvironments

These approaches can be particularly powerful when applied to heterogeneous tissues where ENTPD6 function may vary between cell types, providing insights that would be masked in bulk tissue analyses.

What are common challenges in phenotyping ENTPD6 mouse models and how can they be addressed?

Phenotyping ENTPD6 mouse models presents several challenges that require methodological considerations:

• Enzymatic redundancy issues:

  • Challenge: Other ectonucleotidases may compensate for ENTPD6 deficiency

  • Solution: Implement comprehensive profiling of related enzymes (ENTPD1-8)

  • Approach: Combine targeted activity assays with gene expression analysis

  • Validation: Consider generating compound knockout models to address redundancy

• Tissue-specific expression variability:

  • Challenge: ENTPD6 expression varies across tissues, complicating phenotype interpretation

  • Solution: Implement systematic tissue screening approaches

  • Approach: Use the lacZ reporter in tm1a or tm1b alleles to map expression patterns

  • Validation: Confirm expression patterns through multiple methods (qPCR, western blot, immunohistochemistry)

• Nucleotide measurement challenges:

  • Challenge: Rapid turnover of extracellular nucleotides complicates accurate measurement

  • Solution: Develop optimized nucleotide sampling and preservation protocols

  • Approach: Consider using enzyme inhibitors during sample collection

  • Validation: Implement internal standards and rapid quenching methods

• Phenotypic subtlety:

  • Challenge: ENTPD6 deficiency may produce subtle phenotypes easily missed

  • Solution: Implement high-sensitivity phenotyping protocols

  • Approach: Consider stress conditions that may unmask latent phenotypes

  • Validation: Increase cohort sizes for sufficient statistical power

• Developmental compensation:

  • Challenge: Developmental adaptations may mask the importance of ENTPD6

  • Solution: Utilize inducible knockout strategies in adult mice

  • Approach: Compare constitutive versus acute ENTPD6 deletion

  • Validation: Time-course studies following inducible deletion

Addressing these challenges requires a combination of optimized methodologies, careful experimental design, and appropriate controls to detect and validate ENTPD6-specific phenotypes.

How can I address inconsistent PCR genotyping results for ENTPD6 mouse models?

Inconsistent PCR genotyping results for ENTPD6 mouse models can stem from various technical factors. Here's a systematic troubleshooting approach:

• Sample quality optimization:

  • Issue: Poor DNA quality from tail biopsies or other tissues

  • Solution: Implement standardized tissue collection and DNA extraction protocols

  • Approach: Compare commercial extraction kits versus in-house methods

  • Validation: Include DNA quality/quantity assessment before PCR

• PCR reaction optimization:

  • Issue: Suboptimal PCR conditions for the specific primers

  • Solution: Perform systematic optimization of PCR parameters

  • Approach: Test gradient PCR for optimal annealing temperatures (around the recommended 58°C)

  • Validation: Include positive controls for each genotype during optimization

• Primer-specific troubleshooting:

  • Issue: The published primer sets (Entpd6_35296_F/R, CAS_R1_Term, LacZ primers) may need optimization

  • Solution: Evaluate primer performance individually

  • Approach: Consider redesigning primers if persistent problems occur

  • Validation: Sequence PCR products to confirm specificity

• Multiplex versus individual reactions:

  • Issue: Competition between primers in multiplex reactions

  • Solution: Compare multiplex versus individual PCR reactions

  • Approach: Adjust primer concentrations to balance amplification efficiency

  • Validation: Run side-by-side comparisons with known samples

• Alternative genotyping strategies:

  • Issue: Standard PCR may not be optimal for all samples

  • Solution: Implement complementary genotyping approaches

  • Approach: Consider qPCR-based genotyping for the neo cassette

  • Validation: Southern blotting for complex cases, though not routinely performed as noted in the search results

A standardized troubleshooting protocol incorporating these elements can systematically address inconsistent genotyping results and establish reliable workflows for ENTPD6 mouse colony management.