GSTT2 Human

What is GSTT2 and where is it located in the human genome?

GSTT2 (Glutathione S-transferase theta 2) is a member of the glutathione S-transferase (GST) superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds . This enzyme plays a critical role in cellular detoxification processes by neutralizing potentially harmful compounds. GSTT2 is located on chromosome 22q11.2 alongside GSTT1 and a pseudogene called GSTT2B, which is a duplicate of GSTT2 that lies in a head-to-head arrangement .

The theta class genes have a similar structure, composed of five exons with identical exon/intron boundaries . Within the GST superfamily, human GSTs are divided into five main classes: Alpha, Mu, Pi, Theta, and Zeta, with GSTT2 belonging to the Theta class . The genomic organization of the GSTT2 locus is particularly interesting because it contains complex structural variations that can affect gene expression and function in different populations.

How does GSTT2 differ from other GST family members in terms of substrate specificity?

GSTT2 shows distinct substrate specificity compared to other GST family members, including its closest relative GSTT1, despite sharing 55% amino acid sequence identity . While GSTT1 acts primarily on dichloromethane and related compounds, GSTT2 preferentially detoxifies cumene hydroperoxide, ethacrynic acid, and 1-menaphthyl sulfate . This substrate specificity difference is crucial for understanding the distinct physiological roles these enzymes play in detoxification pathways.

Both GSTT1 and GSTT2 share less than 15% homology with other GST proteins, highlighting the evolutionary divergence of the theta class within the GST superfamily . This divergence in protein structure relates directly to their unique substrate preferences and cellular functions. Researchers investigating GSTT2 should be aware of these specificity differences when designing inhibition studies or substrate competition assays to avoid cross-reactivity with other GST family members.

What is the expression pattern of GSTT2 across human tissues?

GSTT2 is expressed in most human tissues with varying levels of expression across different organs. According to GTex database analysis, GSTT2 shows the highest expression in the prostate, skin, thyroid, and adrenal glands, with notable expression also present in bladder tissue . This tissue-specific expression pattern suggests potential specialized functions in these organs that might be relevant to disease processes.

The variation in expression levels across tissues provides important context for researchers studying GSTT2 in specific disease models. When designing tissue-specific experiments, researchers should account for the baseline expression levels in their target tissue. Additionally, the relative expression of GSTT2 compared to other GST family members within a specific tissue may influence interpretation of functional studies, particularly when examining detoxification capabilities.

What are the main genetic variants affecting GSTT2 expression, and how do they differ across populations?

Two major genomic variants significantly affect GSTT2 expression: a 37-kb deletion and a 17-bp promoter duplication in the GSTT2 locus . These variants are distributed differently across populations, with both being more prevalent in individuals of European descent compared to those of African descent . The 17-bp promoter duplication reduces GSTT2 expression, while the non-duplicated promoter variant, which is associated with higher GSTT2 expression, is more common in African and African descendant populations .

The GSTT2B pseudogene is also frequently deleted in humans, and this deletion significantly reduces GSTT2 expression . The relationship between these genetic variants creates a complex genotype-phenotype correlation that researchers must consider when studying GSTT2 in different populations. The distinct distribution of these variants may contribute to population-specific differences in disease susceptibility, particularly for conditions where GSTT2 plays a protective role.

How should researchers genotype the GSTT2B deletion and GSTT2 promoter variants?

For GSTT2B deletion genotyping, researchers can employ a three-primer PCR approach as described in previous studies . Genomic DNA extracted from tissue samples is amplified using this PCR method, followed by electrophoretic separation to distinguish between different alleles. The specific primers and conditions for this assay are crucial for accurate genotyping and should be carefully optimized.

For the 17-bp promoter duplication variant, standard variant calling from whole genome sequencing data may be challenging due to the duplicative nature of the variant . In the cited research, manual alignment was required as the duplication appears as a deletion relative to the reference sequence (GRCh37) in raw alignment data . Researchers working with this variant should consider the following sequences:

For the duplicated allele: GTGCACGAAGTGGGAGCTCCCGCTGTCTGGCAGCTCCCGCTGTCTGGCAG
For the non-duplicated allele: GTGCACGAAGTGGGAGCTCCCGCTGTCTGGCAGCAGCTGCTCTGCAGGGG

When analyzing sequence data, it's important to enumerate sequences that map around both paralogs to account for alignments that might align to either one, especially when working with data from diverse populations .

How does GSTT2 expression differ between African Americans and European Americans, and what are the implications?

African Americans exhibit significantly higher levels of GSTT2 mRNA in esophageal squamous mucosa compared to European Americans . This difference is associated with the genetic variants discussed above - the 37-kb deletion and 17-bp promoter duplication that reduce GSTT2 expression are more common in European Americans, while the non-duplicated promoter associated with higher expression is more prevalent in African Americans .

The increased GSTT2 expression in African Americans may have protective effects against certain diseases. For example, it may protect against esophageal mucosal damage caused by gastroesophageal reflux disease (GERD) and contribute to the lower incidence of Barrett's esophagus and esophageal adenocarcinoma observed in this population . These findings highlight the importance of considering population genetics in disease risk assessment and suggest that GSTT2 may be a potential biomarker for disease susceptibility with population-specific implications.

What role does GSTT2 play in carcinogenesis and cancer protection?

GSTT2 has been implicated in both carcinogenesis and cancer protection through several mechanisms. It functions primarily as a detoxification enzyme that neutralizes potential carcinogens and reduces oxidative stress, which can protect cells from DNA damage and subsequent malignant transformation . Higher GSTT2 expression has been associated with a reduced risk of several cancer types, including colon cancer, esophageal squamous cell carcinoma, and Barrett's esophagus .

Research has shown that GSTT2 specifically protects esophageal squamous cells against DNA damage from genotoxic stress . In experimental models, reduced GSTT2 protein in esophageal squamous cell lines increased susceptibility to DNA damage under genotoxic stress conditions . This protective function may partially explain population differences in cancer incidence, as higher constitutive GSTT2 expression in certain populations could confer relative protection against specific cancers.

Both GSTT1 and GSTT2 are thought to have important roles in human carcinogenesis, though their specific contributions may differ based on their distinct substrate preferences and tissue expression patterns . When investigating the role of GSTT2 in cancer, researchers should consider both its direct detoxification functions and potential interactions with signaling pathways involved in cell proliferation and survival.

How does GSTT2 modulate the response to BCG immunotherapy in bladder cancer?

GSTT2 has been found to significantly modulate the response to Bacillus Calmette–Guérin (BCG) immunotherapy in non-muscle-invasive bladder cancer treatment . Research has shown that GSTT2 expression was upregulated in human bladder cancer cell lines after brief exposure to BCG, suggesting its involvement in the cellular response to this immunotherapy .

Mechanistically, GSTT2 appears to modulate BCG-related reactive oxygen species (ROS) changes in cells. In experimental studies, blocking GSTT2 expression decreased the percentage of cells with high ROS levels following exposure to BCG, while overexpressing GSTT2 had the opposite effect . This relationship with ROS regulation is likely important for the therapeutic efficacy of BCG.

Additionally, GSTT2 expression affects BCG survival within treated cells, which could influence treatment outcomes. Inhibition of GSTT2 expression in certain cell lines increased BCG survival at 2 hours post-exposure, though this difference disappeared after 24 hours . Conversely, expression of GSTT2 reduced BCG survival in other cell lines . These findings suggest that GSTT2 genetic status could potentially serve as a biomarker for predicting response to BCG immunotherapy in bladder cancer patients.

What experimental approaches can be used to manipulate GSTT2 expression in cancer cell models?

Several experimental approaches have been successfully employed to manipulate GSTT2 expression in cancer cell models. For knockdown experiments, researchers have used siRNA targeting GSTT2 to block its expression . This approach was effective in cell lines with naturally high GSTT2 expression (GSTT2B FL/FL genotype), such as MGH cells .

For overexpression studies, transfection with a plasmid containing the GSTT2 gene has been used successfully in cell lines with naturally low or undetectable GSTT2 expression (GSTT2B Del/Del genotype), such as UMUC-3 cells . This complementary approach allows researchers to examine the effects of both loss and gain of GSTT2 function in relevant cellular contexts.

When designing these experiments, researchers should verify the baseline GSTT2 expression and GSTT2B genotype of their cell lines. According to reported data, cell lines with the GSTT2B FL/FL genotype (such as T24 and MGH) had Ct values of 25 and 24.2 in qPCR analysis, indicating robust expression, while those with the GSTT2B Del/Del genotype (UMUC3 and U937) had Ct values of 36.75 and 35, indicating very low or absent expression . These expression differences should guide the choice of experimental approach for manipulating GSTT2 levels.

What techniques are available for measuring GSTT2 expression at mRNA and protein levels?

For mRNA quantification, quantitative real-time PCR (qRT-PCR) has been effectively used to assess GSTT2 expression levels . When employing this technique, researchers should first extract total RNA from their samples and convert it to cDNA following standard protocols. The selection of appropriate qRT-PCR primers is crucial for specificity, particularly given the sequence similarity between GSTT2 and other GST family members. Published studies have established validated primers and analysis methods for GSTT2 quantification .

For protein detection, several antibodies targeting GSTT2 are commercially available for techniques such as western blotting and immunohistochemistry . Specific antibodies include mouse-derived anti-GSTT2 antibodies (e.g., SAB1405903) for western blot applications and rabbit-derived anti-GSTT2B antibodies (e.g., HPA000750) for immunohistochemistry . Additionally, monoclonal antibodies (e.g., WH0002953M1, clone 1C12) can provide high specificity for GSTT2 detection .

RNA sequencing data can also be analyzed to assess GSTT2 expression across different tissues or experimental conditions. Previous studies have extracted RPKM (Reads Per Kilobase Million) expression data for GSTT2 from resources like the GEUVADIS RNAseq dataset . When analyzing such data, researchers should be mindful of potential mapping issues due to the sequence similarity between GSTT2 and its pseudogene GSTT2B.

How can researchers assess GSTT2 enzymatic activity in experimental systems?

GSTT2 enzymatic activity can be assessed using substrate-specific assays that measure the rate of glutathione conjugation to GSTT2-specific substrates such as cumene hydroperoxide, ethacrynic acid, or 1-menaphthyl sulfate . These assays typically involve spectrophotometric or fluorometric detection of reaction products or substrate depletion over time.

For assessing the functional consequences of GSTT2 activity in cellular systems, researchers can measure reactive oxygen species (ROS) levels as a proxy for GSTT2 detoxification function . In previous studies, researchers evaluated the impact of GSTT2 expression on BCG-induced ROS by manipulating GSTT2 levels through knockdown or overexpression and then measuring cellular ROS . This approach can be adapted to other experimental contexts where GSTT2 is thought to modulate oxidative stress.

Another functional approach is to measure cell survival or DNA damage under conditions of genotoxic stress, as GSTT2 has been shown to protect cells from DNA damage . Techniques such as the comet assay, γH2AX immunostaining (detection of phospho-H2A histone family member X), or other DNA damage markers can be employed to assess the protective function of GSTT2 under various experimental conditions .

What are the key considerations for studying GSTT2 in animal models?

When studying GSTT2 in animal models, researchers should first consider species-specific differences in GSTT2 sequence, expression, and function. GSTT2 orthologs have been identified in various species including mouse (Gstt2), rat (Gstt2), fruit fly (GstT2), naked mole-rat (Gstt2), domestic guinea pig (Gstt2), and thale cress (GSTT2) . These orthologs may have different substrate specificities or expression patterns compared to human GSTT2.

For genetically modified animal models, GSTT2 knockout (KO) mice have been used to study the effects of GSTT2 deficiency . When working with such models, researchers should verify the complete absence of GSTT2 expression and assess potential compensatory changes in other GST family members. Additionally, the phenotypic effects of GSTT2 deletion may be context-dependent, requiring specific challenges or stressors to reveal functional consequences.

In studies involving dendritic cells from GSTT2KO mice, researchers have investigated how GSTT2 affects immune responses . This approach can be valuable for understanding the immunomodulatory functions of GSTT2 beyond its canonical detoxification role. When designing such experiments, appropriate controls (including wild-type animals from the same genetic background) are essential for meaningful comparisons.

How do GSTT2 genetic variants interact with environmental exposures to influence disease risk?

The interaction between GSTT2 genetic variants and environmental exposures represents a complex gene-environment interaction that may significantly influence disease risk. Since GSTT2 functions in detoxification pathways, individuals with reduced GSTT2 expression due to genetic variants (such as the 37-kb deletion or 17-bp promoter duplication) may have diminished capacity to neutralize specific environmental toxins or endogenous compounds .

For example, in esophageal tissues, reduced GSTT2 expression may increase susceptibility to damage from gastroesophageal reflux disease (GERD) . This interaction could partially explain the higher incidence of Barrett's esophagus and esophageal adenocarcinoma in European populations compared to African populations, as the latter generally have higher GSTT2 expression . Researchers investigating these interactions should consider both genetic profiling for GSTT2 variants and careful assessment of relevant environmental exposures.

Gene-environment interaction studies for GSTT2 should employ statistical models that can appropriately account for both genetic factors and exposure variables. These might include logistic regression models with interaction terms, or more sophisticated approaches such as multifactor dimensionality reduction for detecting higher-order interactions.

What are the mechanisms by which natural compounds like cranberry proanthocyanidins (C-PAC) induce GSTT2 expression?

Cranberry proanthocyanidins (C-PAC) have been shown to increase GSTT2 expression in both cell culture models (Het-1A esophageal squamous cells) and in animal models (rats with reflux-induced esophageal damage) . This induction appears to be functionally significant, as C-PAC treatment reduced levels of DNA damage in reflux-exposed rat esophagi, as evidenced by reduced levels of phospho-H2A histone family member X .

The precise molecular mechanisms by which C-PAC induces GSTT2 expression remain an active area of research. Potential mechanisms may involve activation of transcription factors that regulate GSTT2 gene expression, such as those in the antioxidant response element (ARE) pathway. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key transcription factor that regulates many detoxification enzymes including GSTs, and C-PAC may activate this pathway.

Researchers interested in exploring these mechanisms could employ techniques such as chromatin immunoprecipitation (ChIP) to identify transcription factor binding at the GSTT2 promoter following C-PAC treatment, or reporter gene assays to assess the activity of the GSTT2 promoter under various conditions. RNA-seq and proteomic approaches could also identify broader changes in gene expression and signaling pathways induced by C-PAC that might contribute to GSTT2 upregulation.

How does GSTT2 influence inflammatory and immune responses beyond its detoxification role?

Beyond its canonical role in detoxification, emerging evidence suggests that GSTT2 may modulate inflammatory and immune responses. In plants and invertebrates, GSTT proteins have been shown to modulate innate immune responses , raising the possibility that human GSTT2 might have similar functions.

In the context of bladder cancer treatment with BCG immunotherapy, GSTT2 appears to influence both ROS production and BCG survival within cells . These effects could impact the efficacy of immunotherapy by modulating the inflammatory microenvironment and antigen presentation. The precise mechanisms by which GSTT2 affects these processes require further investigation but may involve regulation of redox-sensitive signaling pathways or direct interactions with immune signaling components.

Researchers exploring this aspect of GSTT2 biology might consider experiments using immune cell models with modified GSTT2 expression, followed by assessment of cytokine production, antigen presentation capacity, or other immune function parameters. Additionally, single-cell RNA sequencing of immune populations from models with varying GSTT2 expression could reveal cell type-specific effects on immune function. The use of GSTT2KO mice for in vivo immune challenge experiments represents another valuable approach to understanding the immunomodulatory functions of this enzyme.