KLK11 Human, Sf9

What is KLK11 and what is its molecular structure?

KLK11 (Kallikrein-11) is a member of the human kallikrein gene family, which are serine proteases having various physiological functions. It is one of 15 kallikrein subfamily members found in a cluster on chromosome 19. The protein contains 241 amino acids (19-250 a.a.) and has a theoretical molecular mass of 26.7 kDa, though on SDS-PAGE it typically appears at approximately 28-40 kDa due to glycosylation . KLK11 cleaves synthetic peptides after arginine but not lysine residues .

What are the known alternative names for KLK11?

KLK11 is also known as Kallikrein-11 isoform 1, PRSS20, and TLSP according to literature and protein databases . These alternative designations may appear in different research publications, so researchers should be aware of these synonyms when conducting literature searches.

What are the advantages of using Sf9 insect cells for KLK11 expression?

Sf9 insect cells provide several advantages for expressing complex eukaryotic proteins like KLK11:

• They support post-translational modifications such as glycosylation, which appears to be important for KLK11 as evidenced by its higher molecular weight on SDS-PAGE (28-40 kDa) compared to its theoretical mass (26.7 kDa) .

• Insect cell systems typically offer higher yields of correctly folded, functional proteins compared to bacterial expression systems.

• The expression of KLK11 in Sf9 cells results in a single, glycosylated polypeptide chain that maintains enzymatic activity .

What is the optimal expression construct for KLK11 in Sf9 cells?

KLK11 produced in Sf9 insect cells is typically expressed with a 9 amino acid His tag at the C-Terminus to facilitate purification through affinity chromatography . The construct should include the coding sequence for KLK11 (amino acids 19-250) with appropriate insect cell-specific regulatory elements. Researchers should ensure the signal peptide is replaced with an insect cell-compatible signal sequence if secreted expression is desired.

How is KLK11 typically purified from Sf9 expression systems?

KLK11 expressed in Sf9 insect cells with a His tag is purified by proprietary chromatographic techniques . A typical purification protocol would involve:

• Initial capture using immobilized metal affinity chromatography (IMAC) targeting the His tag

• Secondary purification steps such as ion exchange chromatography to remove contaminants

• Final polishing using size exclusion chromatography if needed

• Buffer exchange to a stabilizing formulation (the final product is often provided as a sterile filtered colorless solution)

How can the His-tag affect KLK11 activity and how can it be removed if necessary?

While the His-tag facilitates purification, it may potentially affect protein folding, function, or crystallization. If removal is necessary, enterokinase (EK) is a precise tool for cutting target proteins with His-tags. The search results mention a "histidine-tagged bovine enterokinase" as "an efficient and readily removable tool to precisely cut target proteins" . Alternatively, TEV (tobacco etch virus) protease could be used depending on the specific tag design .

How can the enzymatic activity of KLK11 be measured?

Since KLK11 cleaves synthetic peptides specifically after arginine residues but not lysine residues , its activity can be measured using:

• Fluorogenic or chromogenic substrates with arginine at the P1 position

• Peptide substrates followed by HPLC analysis of cleavage products

• Activity against physiological protein substrates analyzed by SDS-PAGE or western blotting

The specific assay conditions (buffer composition, pH, temperature, and cofactors) would need to be optimized experimentally.

What signaling pathways are regulated by KLK11?

KLK11 has been shown to regulate several important signaling pathways:

• AKT-mTOR signaling: KLK11 promotes the activation of AKT-mTOR signaling to promote S6K1 and 4EBP1 pathway and protein synthesis . This is particularly relevant in cardiac hypertrophy.

• Wnt/β-catenin signaling: In cancer biology, KLK11 has been implicated in inhibiting the Wnt/β-catenin signaling pathway in esophageal squamous cell carcinoma .

The specific mechanisms by which KLK11 interacts with these pathways may vary by cell type and physiological context.

What role does mTOR signaling play in KLK11-mediated effects?

mTOR (mechanistic target of rapamycin) signaling is a key downstream pathway for KLK11-mediated effects, particularly in cardiac hypertrophy. Research has demonstrated that:

• KLK11 promotes the activation of AKT-mTOR signaling to stimulate S6K1 and 4EBP1, which are pivotal machines for protein synthesis .

• Repression of mTOR with rapamycin (100 nM) blocks the effects of KLK11 on S6K1 and 4EBP1 as well as protein synthesis .

• Rapamycin treatment also blocks the roles of KLK11 in the regulation of cardiomyocyte hypertrophy .

These findings suggest that mTOR activation is necessary for KLK11's hypertrophic effects.

What role does KLK11 play in cardiac hypertrophy?

KLK11 has been identified as a promoter of cardiac hypertrophy through several mechanisms:

• KLK11 is upregulated in human and mouse hypertrophic hearts .

• It promotes cardiomyocyte hypertrophy by activating AKT-mTOR signaling to enhance protein synthesis .

• Knockdown of KLK11 in mouse hearts inhibits transverse aortic constriction (TAC)-induced decline in fraction shortening and ejection fraction .

• KLK11 inhibition reduces the increase in heart weight, cardiomyocyte size, and expression of hypertrophic fetal genes .

These findings suggest KLK11 as a potential therapeutic target for cardiac hypertrophy.

How is KLK11 involved in cancer biology?

KLK11 has significant yet context-dependent roles in cancer biology:

• It suppresses esophageal squamous cell carcinoma by inhibiting cellular proliferation via inhibition of the Wnt/β-catenin signaling pathway .

• Knockdown of KLK11 has been shown to reverse oxaliplatin resistance in some cancer models by inhibiting proliferation and activating apoptosis .

• KLK11 is also involved in colorectal adenocarcinoma, although the specific mechanisms are not fully elucidated in the search results .

These varying effects highlight the complex and tissue-specific roles of KLK11 in cancer.

How can I establish a KLK11-mediated cardiac hypertrophy model in vitro?

Based on published methodologies, a KLK11-mediated cardiac hypertrophy model can be established as follows:

• Culture mouse cardiomyocytes in DMEM supplemented with 10% FBS, using BrdU to repress fibroblast proliferation .

• Before hypertrophy induction, culture cardiomyocytes in FBS-free DMEM for 24 hours .

• Induce cardiomyocyte hypertrophy by treatment with Angiotensin II (Ang II) for 48 hours in FBS-free DMEM .

• For KLK11 overexpression or knockdown:

  • Infect cardiomyocytes with adenovirus for overexpression

  • Transfect with siRNA (sequence: 5′-GCAACATCACAGACACCAT-3′) for knockdown

  • Perform these modifications 24 hours before serum starvation and Ang II treatment .

• Stain cardiomyocytes with an anti-α-actinin antibody for size analysis, measuring cell size with Image J software .

• Analyze the expression of hypertrophy-related fetal genes by quantitative real-time PCR .

How can I quantify protein synthesis in KLK11-mediated hypertrophy?

Protein synthesis, a key feature of cardiomyocyte hypertrophy, can be quantified using the [³H]-leucine incorporation method as described in the literature :

• Treat cardiomyocytes with [³H]-leucine in appropriate media conditions.

• Allow time for incorporation of the radiolabeled amino acid into newly synthesized proteins.

• Harvest cells and precipitate proteins.

• Measure the radioactivity in protein precipitates using a scintillation counter.

• Normalize the results to cell number or total protein content.

This method provides a quantitative assessment of protein synthesis rates and can demonstrate the effects of KLK11 modulation on this process.

How can I validate KLK11 knockdown efficiency in my experiments?

To validate KLK11 knockdown efficiency, employ multiple complementary approaches:

• Quantitative real-time PCR to measure KLK11 mRNA levels using validated primers (e.g., Forward: ATGATTCTCCGACTCATTGCAC, Reverse: TCATAACCCTTGATGATCCTCGT for mouse KLK11) .

• Western blot analysis to assess KLK11 protein levels using a specific anti-KLK11 antibody .

• For in vitro studies, use siRNA with sequence 5′-GCAACATCACAGACACCAT-3′, which has been successfully employed for KLK11 knockdown in cardiomyocytes .

• For in vivo studies, AAV9-mediated shRNA with the same targeting sequence has proven effective .

Always include appropriate controls (e.g., siCtrl sequence: 5′-GCGCGCTTTGTAGGATTCG-3′) and validate knockdown at both mRNA and protein levels .

How do I establish an in vivo model for studying KLK11 in cardiac hypertrophy?

An in vivo model of cardiac hypertrophy for studying KLK11 can be established using the following protocol:

• Prepare AAV9 vectors expressing shRNA targeting KLK11 (sequence: 5′-GCAACATCACAGACACCAT-3′) or control (sequence: 5′-TTCTCCGAACGTGTCACGT-3′) .

• Administer a single intravenous injection of AAV9-shKLK11 or AAV9-shCtrl to one-week-old male C57BL/6 mice via the jugular vein .

• After eight weeks, perform transverse aortic constriction (TAC) or sham surgery to induce cardiac hypertrophy .

• Analyze cardiac function by echocardiography, measuring parameters such as fraction shortening and ejection fraction .

• Assess hypertrophy by:

  • Heart weight measurements

  • Histological analysis using H&E staining

  • Quantification of cardiomyocyte size using Image J

• Analyze expression of hypertrophic fetal genes (e.g., MYH7) by quantitative real-time PCR .

What experimental readouts can be used to measure KLK11 effects in different contexts?

The appropriate experimental readouts depend on the specific function of KLK11 being studied:

• Enzymatic activity:

  • Synthetic peptide substrates with arginine at the P1 position

  • Analysis of cleavage products by HPLC or mass spectrometry

• Signaling pathway analysis:

  • Western blot analysis of phosphorylated proteins in the AKT-mTOR pathway (phospho-AKT, phospho-mTOR, phospho-S6K1, phospho-4EBP1)

  • Luciferase reporter assays for pathway activation (e.g., Wnt/β-catenin pathway)

• Cardiac hypertrophy markers:

  • Cardiomyocyte size (using α-actinin staining)

  • Heart weight measurements

  • Expression of hypertrophy-related genes (MYH7, BNP, ANF) by qPCR

• Protein synthesis assessment:

  • [³H]-leucine incorporation assays

  • Puromycin incorporation (SUnSET assay)

• Cancer model readouts:

  • Cell proliferation assays

  • Apoptosis measurement

  • Cell migration and invasion assays

What is the optimal buffer composition for maintaining KLK11 stability and activity?

While specific buffer optimization for KLK11 would require experimental determination, general considerations for serine proteases like kallikreins include:

• Buffer component (Tris, HEPES, or phosphate) at physiological pH (typically pH 7.2-8.0)

• Salt component (NaCl, typically 100-200 mM) to maintain solubility

• Potential additives:

  • Glycerol (10-20%) to prevent aggregation

  • Low concentrations of reducing agents to prevent oxidation

  • Protease inhibitors if needed to prevent autolysis

  • Calcium or other divalent cations if they enhance stability

KLK11 has been described as being provided in a "sterile filtered colorless solution" , but the exact composition would need to be optimized experimentally.

What considerations are important when designing specific inhibitors for KLK11?

Designing specific inhibitors for KLK11 would require:

• Structural information: Ideally, crystal structures of KLK11 alone or in complex with substrates/inhibitors. While KLK11-specific structural data is limited, studies on related kallikreins like KLK2 (with crystal structures at 1.9 Å resolution) could provide insights .

• Selectivity challenges: Given the high sequence similarity among kallikrein family members, achieving selectivity is challenging. Focus should be placed on unique structural features of KLK11.

• Substrate specificity: KLK11 cleaves after arginine but not lysine residues , suggesting a design strategy focusing on arginine mimetics with KLK11-specific recognition elements.

• Rational design approaches:

  • Structure-based design targeting the active site

  • Allosteric inhibitors targeting unique regulatory sites

  • Peptide-based inhibitors based on optimal substrate sequences

What are the challenges in developing KLK11 as a biomarker for cardiovascular disease?

Given KLK11's role in cardiac hypertrophy , it has potential as a biomarker, but several challenges must be addressed:

• Analytical validation:

  • Developing sensitive and specific assays for KLK11 detection in biological fluids

  • Establishing reference ranges in healthy populations

  • Determining the effects of age, sex, and comorbidities on baseline levels

• Clinical validation:

  • Determining sensitivity and specificity for cardiovascular disease detection

  • Establishing prognostic value in longitudinal studies

  • Comparing performance against established cardiac biomarkers

• Biological confounders:

  • KLK11's involvement in multiple pathways and disease states

  • Potential compensation by other kallikreins

  • Understanding how various treatments affect KLK11 levels

• Implementation considerations:

  • Sample collection and processing standardization

  • Assay reproducibility across different laboratories

  • Integration with existing biomarker panels

How might targeting KLK11 be developed as a therapeutic approach?

Based on KLK11's involvement in disease processes, potential therapeutic approaches include:

• For cardiac hypertrophy:

  • Developing specific KLK11 inhibitors to block its promotion of cardiomyocyte hypertrophy

  • Targeting downstream AKT-mTOR signaling components

  • Using antisense oligonucleotides or siRNA approaches to reduce KLK11 expression

• For cancer applications:

  • Context-dependent approaches: inhibiting KLK11 in cancers where it promotes proliferation

  • Enhancing KLK11 activity in cancers where it acts as a tumor suppressor (e.g., esophageal squamous cell carcinoma)

  • Developing antibody-drug conjugates targeting KLK11-expressing cancer cells

• Delivery considerations:

  • Local vs. systemic administration

  • Targeted delivery systems

  • AAV-mediated gene therapy approaches as demonstrated in mouse models