KRT18 Human

What is KRT18 and what are its primary structural functions in human cells?

KRT18 (Keratin 18) is a type I intermediate filament protein that partners predominantly with the type II keratin KRT8 to form stable heterodimers. Together, they establish a complex cytoskeletal network that provides structural integrity and resilience to epithelial cells . This keratin-based network is essential for maintaining cell shape and stability . As an intermediate filament protein, KRT18 contributes to the mechanical strength of cells and helps them resist physical stress that could otherwise lead to cell rupture or damage.

In skeletal muscle, research indicates that KRT18 serves as an integral component of the intermediate filament network, working complementarily with KRT19 in both assembling keratin-based filaments and transducing contractile forces .

Beyond structural support, what cellular processes involve KRT18?

KRT18 participates in multiple cellular processes beyond cytoskeletal support:

• Uptake of thrombin-antithrombin complexes by hepatic cells (by similarity)

• Filament reorganization when phosphorylated

• Delivery of mutated CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) to the plasma membrane

• Interleukin-6 (IL-6)-mediated barrier protection (in partnership with KRT8)

Pathologically, KRT18 appears to function as an oncogene in several cancers, particularly colorectal cancer, where its expression correlates with advanced clinical parameters and poor prognosis .

What is the most effective methodology for detecting KRT18 in tissue samples?

Several methodologies have proven effective for KRT18 detection, depending on the specific research question:

Immunohistochemistry (IHC):

• Optimal for visualizing KRT18 distribution in formalin-fixed, paraffin-embedded tissues

• Typically employs mouse monoclonal antibodies (e.g., ab233913) at concentrations around 1 μg/ml

• Reveals cytoplasmic localization of KRT18

Western Blot:

• Effective for quantitative protein expression analysis

• Protocol typically includes:

  • Sample preparation by centrifugation (10,000 × g)

  • Protein concentration determination (Modified Lowry Protein Assay Kit)

  • SDS-PAGE (4-12% gradient gel)

  • Transfer to nitrocellulose membranes

  • Blocking in 3% milk in PBS with 0.1% Tween-20

  • Incubation with KRT18 antibody (e.g., DC-10 from Santa Cruz Biotechnology)

RT-PCR:

• For KRT18 mRNA quantification using primers:

  • Forward: GGCCAGCTACCTAGACAAGGTGAAG

  • Reverse: GGATGTCCGCCATGATCTTGCTGAG

  • Yields a product of 488 bp

How does KRT18 deficiency manifest in experimental models and what are its implications for human liver disease?

KRT18 deficiency in mouse models provides important insights into human non-alcoholic fatty liver disease pathogenesis. Studies with aged (17-20-months-old) Krt18−/− mice show they spontaneously develop:

• Progressive pathology beginning with steatosis in younger animals

• Features of steatohepatitis (SH) in older animals

• Liver tumors with male predominance

Histopathological findings in Krt18−/− mice include:

• Hepatocyte anisocytosis and anisokaryosis

• Cleared-out cytoplasm in hepatocytes

• Focal hemorrhagic parenchymal necrosis with neutrophil infiltration

• Mallory-Denk bodies (MDBs) appearing as eosinophilic cytoplasmic clumps in ballooned hepatocytes

Interestingly, heterozygous Krt18+/− mice exhibited more pronounced pathological alterations than homozygous Krt18−/− mice, with higher frequency of liver tumors, particularly in males:

These findings suggest KRT18 deficiency creates an environment conducive to steatohepatitis and hepatocellular neoplasia, with potential implications for understanding human NAFLD progression and the gender disparity observed in clinical settings .

What evidence supports KRT18 as an oncogenic factor and potential therapeutic target in cancer?

Multiple lines of evidence support KRT18's oncogenic role, particularly in colorectal cancer (CRC):

Differential Expression:

• KRT18 protein expression is significantly elevated in CRC tissues (57.4% high expression) compared to normal colorectal tissues (27.8% high expression, p=0.002)

• All tested human CRC cell lines showed KRT18 overexpression compared to normal colonic epithelial cells

• Analysis of TCGA and GTEx databases confirmed dramatically increased KRT18 expression in both colon and rectal cancers compared to normal tissues (p<0.001)

Clinical Correlations in CRC:
KRT18 overexpression significantly correlates with:

Functional Evidence:

• Down-regulation of KRT18 expression in vitro reduced CRC cell viability, migration, and invasion

These findings collectively suggest that KRT18 serves as an oncogenic factor in CRC progression and represents a potential therapeutic target for improving patient prognosis .

How should researchers design experiments to investigate KRT18's role in filament organization and contractile force transduction in muscle tissue?

Based on the available research, a comprehensive experimental approach should include:

Genetic Manipulation Techniques:

• siRNA-mediated knockdown using validated oligonucleotides (e.g., proprietary mixture from Santa Cruz Biotechnology at 3 nM concentration)

• CRISPR/Cas9 gene editing for complete knockout models

• Transgenic mouse models with tissue-specific KRT18 deficiency

Protein Interaction Studies:

• Co-immunoprecipitation to assess KRT18 interactions with KRT8, KRT19, and other cytoskeletal proteins

• Proximity ligation assays to visualize protein-protein interactions in situ

• FRET-based approaches to evaluate dynamic interactions

Structural Analysis:

• Immunofluorescence microscopy with co-staining for KRT18 and KRT19 to evaluate filament organization

• Super-resolution microscopy to visualize fine structural details

• Electron microscopy to examine ultrastructural changes in filament architecture

Functional Assessments:

• Atomic force microscopy to measure cellular stiffness in KRT18-deficient vs. normal muscle cells

• Traction force microscopy to quantify contractile forces

• Ex vivo muscle contractility measurements in KRT18-deficient models

Phosphorylation Studies:

• Site-directed mutagenesis of key phosphorylation sites in KRT18

• Phospho-specific antibodies to monitor phosphorylation status during contraction

• Kinase inhibition experiments to identify regulatory pathways

Such a multifaceted approach would help elucidate KRT18's complementary role to KRT19 in both the assembly of keratin-based filaments and the transduction of contractile forces in skeletal muscle .

What methodological considerations are critical when using KRT18 as a biomarker in cancer research?

Researchers should consider several critical methodological aspects when employing KRT18 as a cancer biomarker:

Sample Selection and Processing:

• Ensure consistent tissue sampling procedures (biopsy location, size, preservation)

• Standardize fixation protocols for IHC (typically formalin-fixed, paraffin-embedded)

• Include matched normal-tumor pairs whenever possible

• Consider tissue microarrays for high-throughput screening

Detection Method Optimization:

• For IHC: Determine optimal antibody concentration (typically 1 μg/ml for anti-KRT18)

• For Western blot: Standardize protein extraction protocols and loading controls

• For RT-PCR: Validate primer specificity and efficiency

• For all methods: Include appropriate positive and negative controls

Scoring and Interpretation:

• Establish clear scoring criteria for KRT18 expression (e.g., percentage of positive cells, staining intensity)

• Use digital image analysis where possible to reduce subjective interpretation

• Correlate expression with standardized clinical parameters (TNM staging, differentiation grade)

Statistical Analysis:

• Determine appropriate cutoff values for "high" versus "low" expression

• Use multivariate analyses to control for confounding variables

• Employ Kaplan-Meier survival analysis with log-rank test for prognostic assessment

• Perform Cox proportional hazards regression to identify independent predictors of survival

Validation Strategies:

• Validate findings in independent cohorts

• Compare results across multiple detection methodologies

• Correlate tissue expression with potential circulating biomarkers

These considerations are essential for establishing KRT18 as a reliable biomarker with clinical utility across different cancer types, particularly given its demonstrated value in colorectal cancer prognostication .

How can researchers effectively investigate the relationship between KRT18 post-translational modifications and its function in disease states?

To investigate KRT18 post-translational modifications (PTMs) and their functional implications, researchers should implement a comprehensive strategy:

Identification of PTM Sites:

• Mass spectrometry-based proteomics to map phosphorylation, glycosylation, acetylation sites

• Phospho-specific antibodies to monitor phosphorylated KRT18 in various cellular contexts

• Special focus on phosphorylation, which is known to regulate filament reorganization

Site-Directed Mutagenesis Approaches:

• Generate phosphomimetic mutants (Ser/Thr to Asp/Glu) and phospho-deficient mutants (Ser/Thr to Ala)

• Introduce the mutants into KRT18-deficient cell lines

• Assess functional consequences on filament organization, cell morphology, and disease-relevant phenotypes

Kinase/Phosphatase Identification:

• Kinase inhibitor screens to identify enzymes regulating KRT18 phosphorylation

• Co-immunoprecipitation to detect physical interactions with modifying enzymes

• siRNA knockdown of candidate kinases/phosphatases to confirm their role in KRT18 regulation

Dynamic PTM Analysis in Disease Models:

• Monitor changes in KRT18 PTMs during disease progression (e.g., steatosis to steatohepatitis)

• Compare PTM patterns between normal and cancer tissues

• Correlate specific PTMs with clinical parameters and outcomes

Functional Studies of Modified KRT18:

• Assess impact of PTMs on KRT18-KRT8 heterodimer formation

• Evaluate changes in filament solubility, organization, and mechanical properties

• Determine effects on interactions with other cellular components

Therapeutic Targeting Strategies:

• Develop compounds that specifically inhibit or enhance disease-relevant KRT18 modifications

• Test their effects in cellular and animal models of disease

• Evaluate potential for clinical application

This approach would provide crucial insights into how phosphorylation and other PTMs regulate KRT18 function in both normal physiology and disease states, potentially identifying novel therapeutic targets.

What is the optimal experimental design for studying KRT18's role in cancer cell invasion and metastasis?

Based on research findings showing KRT18's correlation with invasion and metastasis , an optimal experimental design would include:

In Vitro Models:

• 2D Migration Assays:

  • Wound healing/scratch assays with KRT18-knockdown vs. control cells

  • Transwell migration assays to quantify directional cell movement

• 3D Invasion Assays:

  • Matrigel invasion chambers to assess ECM penetration capacity

  • Spheroid invasion assays in collagen matrices for more physiological assessment

• Cell Line Selection:

  • Utilize paired cell lines with different metastatic potential (e.g., SW480/SW620 for CRC)

  • Generate isogenic lines differing only in KRT18 expression levels

Molecular Mechanisms:

• Adhesion Dynamics:

  • Focal adhesion turnover assays in KRT18-modulated cells

  • Analysis of integrin expression and activation patterns

• Cytoskeletal Interactions:

  • Co-immunoprecipitation of KRT18 with actin, microtubules, and associated proteins

  • Live-cell imaging of cytoskeletal dynamics during migration

• Signaling Pathway Analysis:

  • Phosphoproteomics to identify KRT18-dependent signaling events

  • Targeted inhibition of candidate pathways to establish causality

In Vivo Models:

• Orthotopic Xenografts:

  • Implantation of KRT18-modulated cancer cells into relevant organs

  • Real-time tracking of tumor cell dissemination using bioluminescence

• Metastasis Assays:

  • Tail vein injection to assess extravasation and colonization capacity

  • Quantification of circulating tumor cells in KRT18-high vs. KRT18-low models

Clinical Correlation:

• Tissue Microarray Analysis:

  • KRT18 staining in primary tumors vs. matched metastases

  • Correlation with invasion markers (MMPs, EMT markers)

• Liquid Biopsy Integration:

  • Analysis of circulating KRT18 levels in relation to metastatic burden

  • Correlation with CTCs and disease progression

This comprehensive approach would provide mechanistic insights into how KRT18 overexpression promotes invasion and metastasis in cancers, building on existing correlative clinical data .

How should researchers resolve contradictions in KRT18 knockout phenotypes between different experimental models?

When facing contradictory results between different KRT18 knockout models, researchers should implement a systematic approach to resolve these discrepancies:

Genetic Background Analysis:

• Compare mouse strains used in different studies (the search results mention 129P2/OlaHsd background)

• Generate knockouts on multiple genetic backgrounds to assess strain-dependent effects

• Consider the presence of genetic modifiers that might influence phenotype penetrance

Gene Dosage Evaluation:

• Compare homozygous (Krt18−/−) vs. heterozygous (Krt18+/−) phenotypes

• Note that search results showed more pronounced pathology in Krt18+/− mice than in Krt18−/− mice

• Investigate potential compensatory mechanisms in complete knockout models

Tissue-Specific and Temporal Considerations:

• Employ tissue-specific conditional knockouts to isolate effects

• Use inducible systems to distinguish developmental from adult-onset phenotypes

• Consider age-dependent effects (search results highlight phenotype progression with age)

Sex-Specific Differences:

• Analyze male and female animals separately

• Note significant sexual dimorphism in tumor development (males showed higher tumor frequency)

• Investigate hormonal influences on phenotype expression

Environmental Factors:

• Standardize housing conditions, diet, and microbiome

• Consider environmental stressors that might trigger or exacerbate phenotypes

• Design challenge experiments to reveal latent phenotypes

Molecular Compensation Assessment:

• Profile expression of other keratins that might compensate for KRT18 loss

• Investigate the relationship between KRT18 and KRT19 in different tissues

• Generate double or triple knockouts to overcome functional redundancy

Methodology Standardization:

• Harmonize phenotyping protocols between laboratories

• Establish consistent criteria for pathological assessment

• Use quantitative rather than qualitative measures where possible

By systematically addressing these factors, researchers can better understand context-dependent KRT18 functions and resolve apparent contradictions between experimental models.

What experimental controls are essential when manipulating KRT18 expression for functional studies?

When manipulating KRT18 expression for functional studies, the following controls are essential for rigorous experimental design:

Genetic Manipulation Controls:

• For siRNA Studies:

  • Non-targeting siRNA with similar GC content

  • Multiple siRNA sequences targeting different regions of KRT18 to rule out off-target effects

  • Rescue experiments with siRNA-resistant KRT18 constructs

• For CRISPR/Cas9 Knockout:

  • Non-targeting gRNA controls

  • Single cell-derived clones with sequence verification

  • Multiple independent knockout clones to account for clonal variation

  • Rescue experiments with exogenous KRT18 expression

Expression Verification Controls:

• mRNA Level:

  • RT-PCR with validated primers (e.g., Forward: GGCCAGCTACCTAGACAAGGTGAAG; Reverse: GGATGTCCGCCATGATCTTGCTGAG)

  • Multiple housekeeping genes for normalization (e.g., GAPDH)

• Protein Level:

  • Western blot with validated antibodies

  • Multiple loading controls

  • Immunofluorescence to verify subcellular localization changes

Specificity Controls:

• Assessment of potential compensatory changes in other keratins (especially KRT8 and KRT19)

• Evaluation of heterodimer partner KRT8 expression and localization

• Monitoring of other intermediate filament proteins

Functional Readout Controls:

• For Viability Assays:

  • Multiple timepoints to distinguish acute vs. chronic effects

  • Different methodologies (e.g., MTT, ATP-based assays, cell counting)

• For Migration/Invasion Assays:

  • Proliferation controls to distinguish migration from proliferation effects

  • Both 2D and 3D assay formats to confirm consistent phenotypes

Cell Type Controls:

• Experiments in multiple cell lines to ensure generalizability

• Include both normal and cancer cell lines when studying oncogenic functions

• Controls for cell density and confluency effects

Temporal Controls:

• Time course experiments to capture dynamic effects

• Inducible systems to control onset of KRT18 manipulation

Mechanistic Controls:

• Inhibitors or genetic manipulation of proposed downstream pathways

• Structure-function studies with mutant KRT18 variants

These comprehensive controls ensure that observed phenotypes are specifically attributable to KRT18 manipulation rather than experimental artifacts or off-target effects.

How should researchers interpret differences in KRT18 expression patterns between primary tumors and metastatic lesions?

Interpreting differences in KRT18 expression between primary tumors and metastatic lesions requires a nuanced analytical approach:

Biological Significance Assessment:

• Determine whether KRT18 upregulation is a driver or consequence of metastasis

• Consider whether expression changes reflect selection of pre-existing subclones or adaptive responses

• Evaluate if expression differences correlate with specific metastatic routes or target organs

Pattern Analysis Framework:

• Consistent Upregulation in Metastases:

  • Suggests KRT18 provides a selective advantage during metastatic colonization

  • May indicate importance in survival in circulation or at secondary sites

  • Aligns with findings that KRT18 expression correlates with metastatic potential in CRC

• Consistent Downregulation in Metastases:

  • Could suggest KRT18 inhibits later stages of metastatic cascade

  • May indicate different cytoskeletal requirements at secondary sites

  • Warrants investigation of epithelial-mesenchymal transition dynamics

• Heterogeneous Expression:

  • Might reflect tumor heterogeneity and polyclonal metastatic origin

  • Could indicate context-dependent roles in different microenvironments

  • Should trigger single-cell analysis approaches

Clinical Correlation Approach:

• Correlate expression patterns with specific metastatic sites (liver, lung, lymph nodes)

• Assess whether expression differences predict organ-specific metastatic tropism

• Determine if metastasis-specific patterns correlate with treatment response

Mechanistic Investigation Strategy:

• For upregulated KRT18 in metastases, focus on:

  • Anoikis resistance mechanisms

  • Cell-ECM interactions at secondary sites

  • Adaptation to new microenvironments

• For downregulated KRT18 in metastases, investigate:

  • EMT-related cytoskeletal remodeling

  • Phenotypic plasticity mechanisms

  • Alternative structural proteins compensating for KRT18

Therapeutic Implication Analysis:

• High KRT18 in metastases might indicate utility as a therapeutic target for advanced disease

• Expression differences could inform stage-specific treatment strategies

• Changes might predict sensitivity to cytoskeleton-targeting drugs

The fact that KRT18 expression correlates with lymph node metastasis (p=0.008) and distant metastasis (p=0.001) in CRC provides a foundation for such comparative studies between primary and metastatic lesions.

What is the significance of KRT18 phosphorylation in filament reorganization and how does this impact cellular responses to stress?

The phosphorylation of KRT18 plays a critical role in filament reorganization , with significant implications for cellular stress responses:

Molecular Basis of Phosphorylation-Induced Reorganization:

• Phosphorylation alters the charge distribution on KRT18 molecules

• This modification disrupts inter-filament interactions, promoting filament solubility

• Specific serine residues (likely including those in the head and tail domains) serve as phosphorylation sites

• Phosphorylation enables rapid and reversible reorganization of the keratin network

Functional Consequences in Stress Response:

• Mechanical Stress Protection:

  • Phosphorylation-induced reorganization allows cytoskeletal adaptation to mechanical forces

  • Provides structural plasticity while maintaining cellular integrity

  • May protect against cell rupture during tissue deformation

• Metabolic Stress Response:

  • KRT18 phosphorylation may contribute to stress granule formation

  • Could participate in sequestration of damaged proteins during proteotoxic stress

  • Potentially relevant to the formation of Mallory-Denk bodies seen in Krt18−/− mice

• Oxidative Stress Handling:

  • Phosphorylated KRT18 may interact differently with redox-sensitive proteins

  • Could affect cellular antioxidant responses

  • May influence susceptibility to oxidative damage in steatohepatitis

Signaling Integration:

• KRT18 phosphorylation likely integrates signals from multiple stress-activated kinases

• Serves as both a sensor and effector in stress response pathways

• May coordinate cytoskeletal responses with other cellular stress adaptations

Pathological Implications:

• In Liver Disease:

  • Aberrant KRT18 phosphorylation could contribute to the progression from steatosis to steatohepatitis

  • May influence the formation and composition of Mallory-Denk bodies

  • Could affect hepatocyte resilience to metabolic and inflammatory stress

• In Cancer:

  • Altered phosphorylation patterns might contribute to the increased migration and invasion associated with high KRT18 expression

  • Could influence response to chemotherapeutic agents targeting the cytoskeleton

  • May affect metastatic potential through changes in cellular mechanics

Therapeutic Potential:

• Targeting kinases that phosphorylate KRT18 could modify filament dynamics

• Modulating KRT18 phosphorylation might enhance cellular stress resistance

• Could represent a strategy to normalize cytoskeletal function in disease states

The significant role of phosphorylated KRT18 in filament reorganization provides a foundation for understanding how post-translational modifications of this protein contribute to cellular stress adaptations in both physiological and pathological contexts.

What novel approaches should researchers consider for targeting KRT18 in cancer therapy?

Given KRT18's established role as an oncogenic factor in multiple cancers , several innovative therapeutic approaches warrant investigation:

Direct KRT18-Targeting Strategies:

• Aptamer-Based Approaches:

  • Develop RNA/DNA aptamers that specifically bind KRT18

  • Conjugate with cytotoxic agents for targeted delivery to KRT18-overexpressing cells

  • Engineer aptamers that disrupt KRT18-KRT8 heterodimer formation

• Proteolysis-Targeting Chimeras (PROTACs):

  • Design bifunctional molecules linking KRT18-binding ligands to E3 ubiquitin ligase recruiters

  • Induce selective proteasomal degradation of KRT18 in cancer cells

  • Overcome limitations of traditional inhibition approaches

Phosphorylation-Modulating Approaches:

• Kinase Inhibition:

  • Identify and target kinases specifically involved in cancer-associated KRT18 phosphorylation

  • Develop inhibitors that prevent filament reorganization required for migration/invasion

  • Focus on phosphorylation events linked to KRT18's role in filament reorganization

• Phosphatase Activation:

  • Activate phosphatases that dephosphorylate KRT18

  • Stabilize keratin filaments to restrict cancer cell plasticity and motility

Transcriptional Regulation Approaches:

• Epigenetic Modulation:

  • Target epigenetic modifiers controlling KRT18 expression

  • Develop selective enhancer-blocking compounds

  • Explore CRISPR-based epigenome editing of KRT18 regulatory regions

• Antisense Oligonucleotides/siRNA Therapeutics:

  • Develop delivery systems for KRT18-targeting oligonucleotides

  • Leverage nanoparticle technology for tumor-specific delivery

  • Design modified siRNAs with enhanced stability and specificity

Immune-Based Approaches:

• CAR-T Cell Therapy:

  • Generate CAR-T cells recognizing KRT18-derived peptides presented on cancer cells

  • Explore dual-targeting approaches to enhance specificity

  • Investigate potential for targeting circulating tumor cells with high KRT18 expression

• Antibody-Drug Conjugates:

  • Develop antibodies targeting cancer-specific KRT18 conformations or modifications

  • Conjugate with cytotoxic payloads for selective delivery

  • Optimize internalization and drug release properties

Synthetic Lethality Approaches:

• Identify Genetic Dependencies:

  • Screen for genes synthetically lethal with high KRT18 expression

  • Target partner proteins essential for KRT18's oncogenic functions

  • Explore dependencies on specific cytoskeletal regulators in KRT18-high cancers

Combination Strategies:

• Sensitization to Standard Therapies:

  • Investigate KRT18 inhibition as a means to overcome chemoresistance

  • Explore synergies with cytoskeleton-targeting agents

  • Develop rational combinations based on KRT18-dependent pathways

The strong correlation between KRT18 expression and poor prognosis in colorectal cancer provides a compelling rationale for pursuing these therapeutic approaches, potentially offering new strategies for patients with KRT18-overexpressing tumors.

What are the most promising research directions for understanding KRT18's tissue-specific functions in normal physiology?

Understanding KRT18's tissue-specific functions in normal physiology represents an important research frontier, with several promising directions:

Comparative Analysis Across Epithelial Tissues:

• Differential Interactome Mapping:

  • Apply proximity labeling techniques (BioID, APEX) to identify tissue-specific KRT18 interacting partners

  • Compare KRT18 protein complexes across hepatocytes, intestinal epithelium, and other expressing tissues

  • Identify tissue-specific adaptors and regulatory proteins

• Transcriptomic Co-expression Networks:

  • Analyze tissue-specific co-expression patterns to identify functional networks

  • Compare KRT18 regulatory mechanisms across tissues

  • Identify tissue-specific transcription factors controlling KRT18 expression

Advanced Structural Biology Approaches:

• Cryo-Electron Microscopy:

  • Determine high-resolution structures of tissue-specific KRT18-KRT8 filaments

  • Investigate structural differences in filament organization across tissues

  • Analyze how tissue-specific post-translational modifications alter filament structure

• In-Cell NMR:

  • Characterize dynamic aspects of KRT18 in living cells from different tissues

  • Monitor conformational changes during cellular processes

  • Identify tissue-specific structural adaptations

Mechanical Functions in Different Contexts:

• Biomechanical Characterization:

  • Compare mechanical properties of KRT18-containing filaments across tissues

  • Correlate with tissue-specific mechanical requirements

  • Investigate KRT18's role in contractile force transduction in muscle

• Mechanotransduction Studies:

  • Analyze KRT18's role in converting mechanical stimuli to biochemical signals

  • Compare mechanosensitive pathways across tissues

  • Investigate interactions with tissue-specific mechanosensors

Tissue-Specific Conditional Models:

• Inducible Tissue-Specific Knockout Systems:

  • Generate conditional KRT18 knockout models for specific tissues

  • Analyze acute vs. chronic effects of KRT18 loss

  • Investigate compensatory mechanisms in different cellular contexts

• Tissue-Specific Phospho-Mutant Models:

  • Create knockin mice expressing phospho-deficient or phosphomimetic KRT18 in specific tissues

  • Analyze impact on filament reorganization in different cell types

  • Determine functional consequences for tissue-specific stress responses

Developmental Dynamics:

• Lineage-Tracing Studies:

  • Track KRT18 expression during tissue development and specification

  • Investigate potential roles in epithelial differentiation programs

  • Analyze interactions with developmental signaling pathways

• Single-Cell Multi-Omics:

  • Profile KRT18 expression, modifications, and interactions at single-cell resolution

  • Map changes during tissue development and homeostasis

  • Identify cell-state-specific functions

Non-Mechanical Functions:

• Signaling Scaffold Roles:

  • Investigate KRT18's function in organizing signaling complexes

  • Compare signaling roles across tissues

  • Analyze tissue-specific consequences of KRT18-mediated signaling

• Cell Death Regulation:

  • Explore KRT18's role in tissue-specific apoptotic pathways

  • Investigate caspase-mediated cleavage in different contexts

  • Analyze fragment-specific functions across tissues

These research directions would significantly advance our understanding of KRT18's diverse roles beyond its well-established structural functions, potentially revealing new therapeutic opportunities for tissue-specific pathologies.