Monkeypox A33R

What is the Monkeypox virus A33R protein and what is its significance in viral pathology?

The A33R protein is a key antigen of the Monkeypox virus, which belongs to the same family as smallpox but causes a less severe disease in humans . This protein has a calculated molecular weight of 88.7 kDa but migrates as 90-100 kDa when analyzed by SDS-PAGE due to glycosylation . A33R plays a crucial role in virus-host interactions and represents an important target for immune response, making it valuable for both diagnostic and vaccine development purposes.

Structurally, A33R contains C-type lectin-like domains (CTLDs) that occur as dimers in A33 crystals . This structural characteristic is significant for understanding its function and interactions with host immune factors, which is essential for developing effective countermeasures against Monkeypox infections.

What are the key structural characteristics of the A33R protein based on crystallography studies?

The structure of the A33R protein has been determined through X-ray crystallography, revealing C-type lectin-like domains (CTLDs) that form dimers . Multiple crystal forms have been observed with different space groups including P2₁, P2₁2₁2, P2₁2₁2₁, and C2, with resolutions ranging from 2.1-2.3 Å . The asymmetric unit typically contains two A33R monomers.

Structural analysis has been conducted using various computational tools including PISA for calculating buried surface areas, SC software for shape complementarity statistics, and DALI, SSM, and FFAS servers for structural database searches . These analyses provide essential insights into protein-protein interactions and potential binding sites that may be relevant for vaccine and therapeutic development.

How does A33R contribute to immune response against Monkeypox virus?

A33R is highly immunogenic and stimulates the production of specific antibodies during Monkeypox infection. Detection of IgG antibodies against the A33R protein can help in the diagnosis of Monkeypox virus infection and monitoring of immune response post-infection . This makes A33R an important biomarker for both diagnostic and prognostic purposes.

In vaccine development, A33R has been identified as a promising target for inducing protective immunity. Studies have shown that when combined with other viral antigens such as L1R and B5R, A33R can elicit stronger protective responses . For example, when rhesus monkeys were vaccinated with vaccines that combined VACV L1R and A33R genes, they showed enhanced protection against poxvirus challenge .

What methods are recommended for expression and purification of recombinant A33R protein?

For successful expression and purification of recombinant A33R protein, the following methodological approach has been validated:

Expression System:

• E. coli strain BL21(DE3)-RIL-X grown at 37°C in selenomethionine (SeMet) medium for structural studies

• Induction with 0.5 mM isopropyl-β-d-thiogalactopyranoside (IPTG) when optical density at 600 nm reaches 0.6

• Expression continues for 4-6 hours before harvesting by centrifugation at 4,000 × g

Purification Protocol:

• Cell lysis in buffer containing 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP-40

• Protein refolding by rapid dilution in buffer with 100 mM Tris-HCl (pH 8.0), 800 mM arginine-HCl, 0.5 mM oxidized glutathione, and 5 mM reduced glutathione

• Dialysis against 10 mM Tris-HCl (pH 8.0)

• Size exclusion chromatography using Superdex 75

• Final concentration and quality assessment by SDS-PAGE

This methodological approach yields properly folded A33R protein suitable for structural studies, immunological assays, and vaccine development research.

What crystallization techniques have proven successful for structural analysis of A33R?

The structural determination of A33R has been achieved through various crystallization approaches:

Crystallization Conditions:
Different crystal forms have been obtained with the following parameters:

Phase Determination:

• Single-wavelength anomalous diffraction experiments using selenomethionine-incorporated protein

• Data collection at peak, edge, and high remote Se energies

• Best electron density maps obtained using the high-energy remote data set alone

Structure Refinement:

• Density modification and automated model building performed using the RESOLVE software program

• Model geometry and side-chain rotamer conformations examined using Procheck and corrected using Molprobity

This technical approach has successfully revealed the dimeric structure of A33R with C-type lectin-like domains, providing crucial insights for structure-based vaccine design.

How can researchers effectively design experiments to study A33R-antibody interactions?

To effectively study A33R-antibody interactions, researchers should consider the following experimental approaches:

Binding Assays:

• Immobilize purified A33R protein (1 μg/mL) on microplate wells to bind anti-Monkeypox virus A33R antibodies

• Establish a linear binding range (e.g., 1-63 ng/mL has been validated)

• Use ELISA-based methods with biotinylated detection antibodies and HRP-streptavidin for visualization

Equipment Requirements:

• Microplate reader capable of measuring absorbance at 450 nm

• Precision pipettes for accurate reagent delivery

• Appropriate controls (positive and negative) to validate results

Analytical Considerations:

• Ensure proper protein folding prior to binding studies, as this is critical for maintaining native epitopes

• Consider the impact of glycosylation on antibody recognition, as A33R is heavily glycosylated

• Use molecular dynamics simulations to predict antibody binding sites

These methodological approaches provide a framework for characterizing A33R-antibody interactions, which is essential for both diagnostic development and therapeutic antibody discovery.

How can immunoinformatic approaches be utilized to identify immunogenic epitopes of A33R for vaccine design?

Immunoinformatic approaches offer powerful methods for identifying immunogenic epitopes in A33R for vaccine development:

Epitope Prediction Workflow:

• Obtain A33R protein sequence from reliable databases for analysis

• Screen for immunogenic cytotoxic T-lymphocyte (CTL), helper T-lymphocyte (HTL), and B-cell epitopes

• Evaluate predicted epitopes for antigenicity and non-allergenicity to ensure safety

• Join selected epitopes using appropriate linkers to construct multi-epitope subunit vaccines (MESVs)

• Predict 3D structure of the constructed vaccine candidate

• Validate proper folding through molecular dynamics simulation analysis

• Verify binding affinity with human toll-like receptors (e.g., TLR-2) through molecular docking

• Optimize codon usage for high expression in selected expression vectors (e.g., pET-28a(+))

• Use immune response simulation to predict antibody production patterns

This comprehensive immunoinformatic approach has successfully identified highly antigenic and non-allergenic epitopes from A33R that generate specific and robust immune responses, providing a rational basis for MESV design against monkeypox virus .

What strategies have proven effective for combining A33R with other viral proteins in vaccine formulations?

Research has demonstrated several effective strategies for combining A33R with other viral proteins to enhance vaccine efficacy:

Validated Protein Combinations:

• A33R + L1R: Mice immunized with vaccines combining these genes showed enhanced protection against poxvirus challenge

• A33R + B5R: This combination has demonstrated improved protective efficacy in animal models

• Four-gene combination (A33R + L1R + A27L + B5R): This approach elicited antibody responses in rhesus monkeys that cross-reacted with homologous proteins of monkeypox

Design Considerations:

• Select complementary proteins that target different aspects of viral infection cycle

• Optimize gene arrangement and expression levels

• Consider different delivery platforms (DNA vaccines, protein subunits, viral vectors)

• Evaluate adjuvant formulations to enhance immunogenicity

This multi-target approach addresses the complexity of viral infection and immune evasion mechanisms, potentially leading to more effective and broadly protective vaccines against monkeypox.

What animal models are most appropriate for evaluating A33R-based vaccine candidates?

The selection of appropriate animal models is crucial for evaluating A33R-based vaccine candidates:

Validated Animal Models:

• Mice:

  • Useful for initial immunogenicity studies and dose optimization

  • Successfully used to demonstrate protection with A33R+L1R combination vaccines

• Rhesus Macaques:

  • More closely model human immune responses

  • Validated for testing four-gene combination vaccines including A33R

  • When vaccinated with the ACAM2000 vaccine (which contains A33R), high concentrations of neutralizing and IgG antibodies were detected

Experimental Design Considerations:

• Immunization route and schedule

• Challenge virus strain and dose

• Immune correlates assessment (antibody titers, T-cell responses)

• Protection parameters (viral load, clinical signs, survival)

Rhesus macaques represent the gold standard for pre-clinical evaluation of monkeypox vaccines due to their similar disease progression to humans and translatable immune responses, though mice may be appropriate for early-stage studies and mechanism investigations.

How can A33R protein be utilized in diagnostic assays for Monkeypox virus infection?

A33R protein serves as an excellent target for diagnostic assays due to its immunogenicity and specificity:

Diagnostic Applications:

• Detection of human IgG antibodies against A33R protein for diagnosis of Monkeypox virus infection

• Monitoring immune response post-infection or vaccination

• Epidemiological surveillance studies

ELISA-Based Diagnostic Protocol:

• Pre-coated 96-well microplates with A33R protein

• Addition of patient serum or plasma samples

• Application of biotinylated detection antibodies

• Signal development using HRP-streptavidin and TMB substrate

• Quantification using a microplate reader at 450 nm

This approach provides quantitative results and can detect both active and recent infections through the presence of specific anti-A33R antibodies, offering advantages over PCR-based methods that only detect active viral replication.

What are the technical considerations for optimizing A33R-based diagnostic assays?

Optimizing A33R-based diagnostic assays requires attention to several technical factors:

Protein Quality Factors:

• Ensure >90% purity of A33R protein as determined by SDS-PAGE

• Maintain proper folding of A33R to preserve conformational epitopes

• Consider the impact of glycosylation on epitope presentation

Assay Optimization Parameters:

• Determine optimal coating concentration (e.g., 1 μg/mL has been validated)

• Establish appropriate sample dilutions to achieve linear range detection

• Include positive and negative controls in each assay run

• Validate with panels of known positive and negative samples

Storage and Stability Considerations:

• For long-term storage, maintain lyophilized A33R protein at -20°C or lower

• Avoid repeated freeze-thaw cycles of protein reagents

• For reconstituted A33R, follow specific instructions in Certificate of Analysis

These technical considerations ensure reliable, reproducible results in A33R-based diagnostic assays, which are essential for both clinical applications and research studies.

What molecular dynamics approaches are recommended for studying A33R protein folding and stability?

Molecular dynamics (MD) simulations provide valuable insights into A33R protein folding and stability:

Recommended MD Protocol:

• Prepare the system using the FF19SB force field and TIP3 box (12.0 Å) for solvation

• Neutralize the system using Na+ counter ions

• Perform two-step minimization (3000 and 6000 steps) to remove bad clashes

• Conduct heating to 300K and equilibration at 1 atm pressure

• Run production simulations for at least 50 ns

• Calculate root-mean-square deviation (RMSD) and root-mean-square fluctuation (RMSF) using CPPTRAJ and PTRAJ packages in AMBER 20

Analysis Parameters:

• RMSD analysis to assess structural stability over time

• RMSF calculation to identify flexible regions

• Hydrogen bond analysis to understand structural integrity

• Analysis of secondary structure elements throughout the simulation

This approach provides detailed information about protein folding, stability, and flexibility, which is essential for understanding A33R function and for rational design of vaccines or therapeutics targeting this protein .

What mutagenesis strategies can be employed to study functional domains within A33R?

Targeted mutagenesis has proven valuable for investigating functional domains within A33R:

Validated Mutagenesis Approaches:

• Site-Directed Mutagenesis:

  • Specific mutations such as L118M, L140M, and K123A/C have been successfully introduced

  • These mutations facilitate structural studies and functional characterization

• PCR-Based Mutation Strategy:

  • Use of complementary primers containing desired mutations:

    • Example for L118M: 5′ primer CAGACTACCAGATGTTCTCGGATGC and 3′ primer GCATCCGAGAACATCTGGTAGTCTG

    • Example for K123A: 5′ primer CAGATGTTCTCGGATGCTGCGGCAAATTGCACTGCGG and 3′ primer CCGCAGTGCAATTTGCCGCAGCATCCGAGAACATCTG

• Domain Truncation:

  • Creation of shorter constructs (e.g., residues 90-185) to focus on functional domains

  • 5′ primer GGGAATTCTAAGGAGGATATTCATATGAGCACTACACAATATGATCACAAAGAAAG with appropriate 3′ primers

Functional Analysis of Mutants:

• Comparative structural studies of wild-type versus mutant proteins

• Binding assays to assess interactions with antibodies or other ligands

• Immunogenicity testing of mutant proteins

These mutagenesis approaches provide crucial insights into structure-function relationships of A33R, facilitating the identification of critical domains for vaccine development and therapeutic targeting.

How does glycosylation affect the structural and immunological properties of A33R?

Glycosylation significantly impacts both the structural and immunological properties of A33R:

Structural Effects:

• A33R has a calculated molecular weight of 88.7 kDa but migrates as 90-100 kDa on SDS-PAGE due to glycosylation

• Glycosylation may influence protein folding, stability, and solubility

• Glycan moieties can affect crystal formation and diffraction quality in structural studies

Immunological Implications:

• Glycan structures can form part of important epitopes

• Glycosylation patterns may affect antibody recognition and binding affinity

• Differences in glycosylation between recombinant and native A33R may impact vaccine efficacy

Analytical Considerations:

• Comparison between glycosylated and enzymatically deglycosylated A33R

• Mass spectrometry analysis to identify glycosylation sites and structures

• Evaluation of glycosylation impact on antibody binding using glycoform-specific antibodies

Understanding the role of glycosylation is essential for developing effective diagnostics and vaccines based on A33R, as glycan structures can significantly influence antigen processing, presentation, and antibody recognition.