PECAM1 Human

What is the molecular structure of human PECAM-1?

Human PECAM-1 is a 130 kDa type I transmembrane glycoprotein consisting of:

• Six extracellular immunoglobulin-like (IgL) homology domains

• A 19-residue transmembrane domain

• A 118-residue cytoplasmic tail containing immunoreceptor tyrosine-based inhibitory motifs (ITIMs)

The extracellular region contains nine potential glycosylation sites, with three localized on IgL1-2 (N52 and N84 on IgL1, and N151 on IgL2) . Domain 1 contains residues important for homophilic PECAM-1/PECAM-1 interactions, while heterophilic binding interactions primarily involve domains 5 and 6 .

Where is PECAM-1 expressed in human tissues?

PECAM-1 displays a distinctive expression pattern characterized by:

• High enrichment at interendothelial junctions of vascular endothelial cells

• Expression on platelets, neutrophils, monocytes, and selected lymphocyte subsets

• Presence on a small percentage of certain T-cell subsets (Th1 and Th2)

This expression profile is critical for understanding PECAM-1's roles in various physiological contexts including vascular integrity, inflammation regulation, and immune cell trafficking.

What are the primary functional roles of human PECAM-1?

Human PECAM-1 serves multiple functions through both homophilic and heterophilic binding patterns:

Pro-inflammatory roles:

• Facilitates leukocyte transendothelial migration

• Transduces mechanical signals in endothelial cells from fluid shear stress

• Functions as a vascular mechanosensor

Anti-inflammatory roles:

• Dampens leukocyte activation

• Suppresses pro-inflammatory cytokine production

• Maintains vascular barrier integrity

Additional functions:

• Plays a crucial role in angiogenesis and vascular remodeling

• Mediates neutrophil diapedesis across the vascular wall

• Contributes to platelet function

What are the recommended approaches for studying PECAM-1 expression in human samples?

For comprehensive analysis of PECAM-1 expression, researchers should consider multiple complementary techniques:

Transcriptional analysis:

• qPCR using validated primer pairs (e.g., Forward: AAGTGGAGTCCAGCCGCATATC, Reverse: ATGGAGCAGGACAGGTTCAGTC)

• Analysis of microarray data from tissue samples (particularly useful for comparing expression in pathological vs. normal tissues)

Protein detection:

• Flow cytometry using specific antibodies (e.g., PerCP-conjugated anti-CD31/PECAM-1)

• Immunohistochemistry for tissue localization

• Western blotting for protein expression levels

When analyzing PECAM-1 expression in disease contexts, compare levels in affected tissues with appropriate controls. For example, in MS studies, researchers compared PECAM-1 expression in periplaque white matter, initial lesions, and active demyelinating lesions to normal white matter from controls .

How can researchers effectively study PECAM-1-mediated cell adhesion and migration?

In vitro migration assays:

• Transwell migration assays with Matrigel-coated filters

• Wound-healing (scratch) assays with endothelial cell monolayers

• Tube formation assays with human umbilical vein endothelial cells (HUVEC)

Functional antibody blocking:

• Use anti-PECAM-1 blocking antibodies to assess its role in specific processes

• Include appropriate controls (e.g., anti-CD99 or anti-ICAM-1) to validate experimental setup

Cell models:

• Transfection of PECAM-1 into cellular models to assess its contribution to adhesion and motility

• PECAM-1 knockout or knockdown models using siRNA or CRISPR-Cas9

When designing these experiments, carefully consider the specific endothelial cell type and activation state, as PECAM-1 functions may vary depending on the vascular bed and inflammatory conditions.

What mutation strategies are effective for studying PECAM-1 function?

Several mutation approaches have proven valuable for investigating PECAM-1 structure-function relationships:

Glycosylation site mutations:

• Mutate N-glycosylation sites (N52, N84, N151) to examine the role of glycosylation in PECAM-1 function

• Use mammalian expression systems (e.g., HEK293) to maintain native glycosylation patterns

Interface disruption mutations:

• Target residues in the hydrophobic center of interaction interfaces (e.g., L74, I112, F188, I190) by substituting with charged residues (e.g., glutamic acid)

• These mutations can disrupt intermolecular binding of PECAM-1

Domain-specific mutations:

• Target specific residues in domain 1 to disrupt homophilic interactions

• Modify domains 5-6 to alter heterophilic binding properties

When creating PECAM-1 mutants, consider using a full-length construct for cellular expression studies and isolated domains for structural and biochemical analyses.

What is the role of PECAM-1 in multiple sclerosis (MS) and its experimental models?

PECAM-1 demonstrates complex roles in MS pathogenesis:

Evidence from animal models:

• PECAM-1−/− C57BL/6 mice display aggravated clinical experimental autoimmune encephalomyelitis (EAE) with impaired blood-brain barrier integrity

• Accelerated immune cell infiltration into the CNS occurs in PECAM-1 deficient models

Evidence from human MS studies:

• Elevated serum levels of soluble PECAM-1 in relapsing-remitting MS patients

• Increased numbers of circulating PECAM-1-positive microparticles

• Increased expression of PECAM-1 on circulating leukocytes

Therapeutic implications:

• Interferon-β treatment increases vascular PECAM-1 expression, suggesting elevated PECAM-1 might contribute to MS amelioration

• PECAM-1 may be critical for BBB stabilization rather than T-cell diapedesis itself

Despite the evidence suggesting PECAM-1 involvement in MS, functional antibody-mediated blockade of endothelial PECAM-1 does not interfere with the transmigration rate of different T-cell subsets across a TNF-α/IFN-γ-stimulated human BBB model, suggesting complex context-dependent roles.

How does PECAM-1 contribute to tumor angiogenesis and what are the therapeutic implications?

PECAM-1 plays significant roles in tumor angiogenesis through several mechanisms:

Evidence from human-mouse chimeric models:

• Antibodies against human PECAM-1 decreased the density of human vessels associated with tumors grown in human skin transplanted on SCID mice

• This effect occurred without simultaneous treatment with anti-VE-cadherin antibody, indicating an independent role for PECAM-1

Cellular mechanisms:

• Anti-PECAM-1 antibodies inhibit tube formation by human umbilical vein endothelial cells

• PECAM-1 facilitates endothelial cell migration through Matrigel and during wound repair

• Expression of human PECAM-1 in cellular transfectants induces tube formation and enhances cell motility

These findings suggest PECAM-1 as a potential therapeutic target in tumor angiogenesis, where blocking its function could inhibit new vessel formation supporting tumor growth.

What is known about PECAM-1's role in atherosclerosis and vascular inflammation?

PECAM-1 functions at the intersection of mechanical forces and inflammatory responses in atherosclerosis:

Mechanosensing in atherosclerosis:

• Low and turbulent blood flow is a determinant of localized atherosclerotic lesions at arterial bifurcations and branch points

• PECAM-1 functions as a mechanosensitive molecule, responding to shear stress

Mechanosensory complex:

• PECAM-1 forms a mechanosensory complex with VE-cadherin and VEGFR2

• Within this complex, PECAM-1 directly transmits mechanical force

• VE-cadherin functions as an adaptor molecule

• VEGFR2 activates PI3K signaling

Dual inflammatory roles:

• PECAM-1 demonstrates both pro-inflammatory functions (facilitating leukocyte migration) and anti-inflammatory functions (maintaining vascular barrier integrity)

• This dual nature suggests complex roles in atherosclerotic plaque formation and stability

Understanding PECAM-1's integration of mechanical and inflammatory signals provides insights into targeting this molecule for atherosclerosis treatment.

How do homophilic versus heterophilic interactions of PECAM-1 differentially regulate its cellular functions?

PECAM-1 engages in both homophilic (PECAM-1/PECAM-1) and heterophilic interactions that lead to distinct functional outcomes:

Homophilic interactions:

• Mediated primarily by extracellular Ig-homology domain 1

• Trigger upregulation of integrin α6β1 on neutrophils, enabling them to traverse the perivascular basement membrane

• Essential for endothelial cell-cell adhesion and vascular integrity

Known heterophilic binding partners:

• CD177 (NB1) on neutrophils - physiologically relevant interaction

• Various integrins: αvβ3 (in endothelial cells), β1 and β2 integrins (in T cells), β1 integrins (in macrophages), β2 integrins (in NK cells), and αMβ2 (Mac-1, CD11b/CD18) in monocytes and neutrophils

Functional consequences:

• Leukocytes lacking PECAM-1 cannot efficiently transmigrate and remain trapped between the endothelium and perivascular basement membrane

• The specific binding partner engaged by PECAM-1 determines downstream signaling events and cellular responses

Future research should focus on developing tools to selectively block specific PECAM-1 interactions to better understand their distinct contributions to PECAM-1 biology.

What are the molecular mechanisms underlying PECAM-1's seemingly contradictory pro- and anti-inflammatory functions?

The dual nature of PECAM-1 in inflammation remains incompletely understood:

Pro-inflammatory mechanisms:

• Facilitates leukocyte transendothelial migration

• Transduces mechanical signals from fluid shear stress

• Contributes to angiogenesis and vascular remodeling

Anti-inflammatory mechanisms:

• Dampens leukocyte activation

• Suppresses pro-inflammatory cytokine production

• Maintains vascular barrier integrity

Potential explanatory factors:

• Tissue-specific expression and binding partners

• Differential glycosylation states affecting binding specificity

• Contextual signaling environment

• Temporal dynamics of PECAM-1 engagement

Research approaches to resolve this paradox should include:

• Temporal analysis of PECAM-1 signaling during inflammatory responses

• Tissue-specific conditional knockout models

• Glycovariants of PECAM-1 to assess glycosylation effects

• Targeted mutations of specific interaction domains to separate pro- from anti-inflammatory functions

How can structural insights into PECAM-1 trans-homophilic interactions inform the development of targeted therapeutics?

Structural studies of PECAM-1 provide critical insights for therapeutic development:

Key structural features:

• The trans-homophilic interaction interfaces involve specific residues in the IgL domains

• Hydrophobic interactions play a central role in PECAM-1 binding (key residues: L74, I112, F188, I190)

• Glycosylation at specific sites (N52, N84, N151) may modulate binding interactions

Therapeutic development strategies:

• Design peptide inhibitors that mimic key interaction interfaces

• Develop antibodies targeting specific epitopes to block select functions while preserving others

• Create small molecule inhibitors of PECAM-1 dimerization

• Engineer glycovariants with altered binding properties

When developing PECAM-1-targeted therapeutics, consider:

• The potential dual effects on inflammation and vascular integrity

• Tissue-specific targeting to minimize off-target effects

• Temporal control of inhibition to match disease progression

• Combination approaches targeting other components of PECAM-1 signaling complexes

What are the critical factors to consider when designing experiments to study PECAM-1 in human cells and tissues?

Researchers should address several key considerations for robust PECAM-1 studies:

Expression system selection:

• Use mammalian expression systems (e.g., HEK293) for studies requiring native glycosylation

• Insect cell systems may yield different glycosylation patterns affecting function

Cell activation state:

• PECAM-1 function varies with endothelial activation state

• For inflammatory models, appropriate cytokine stimulation (e.g., TNF-α, IFN-γ) is crucial

Species specificity:

• Human and mouse PECAM-1 have important structural and functional differences

• Anti-human PECAM-1 antibodies decreased human but not murine vessel density in chimeric models

Experimental controls:

• Include appropriate control antibodies (e.g., anti-CD99, anti-ICAM-1) to validate experimental setups

• Use both positive and negative controls for functional assays

Assay selection based on research question:

• Migration studies: Matrigel invasion assays, wound healing

• Angiogenesis: Tube formation assays

• Barrier function: Transendothelial electrical resistance, permeability assays

• Protein interactions: Co-immunoprecipitation, proximity ligation assays

What approaches are recommended for investigating PECAM-1 signaling pathways?

PECAM-1 engages multiple signaling pathways that require specific experimental approaches:

Key PECAM-1 signaling components:

• Immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in the cytoplasmic domain

• Association with PI3K and other kinases

• Connection to integrin activation pathways

Recommended experimental approaches:

• Phosphorylation studies using phospho-specific antibodies

• Pull-down assays to identify binding partners

• Pharmacological inhibition of suspected downstream pathways

• Targeted mutagenesis of key cytoplasmic tyrosine residues

• Live cell imaging with fluorescent reporters for real-time signaling visualization

Specific techniques for mechanosensing studies:

• Flow chambers with controlled shear stress

• Assessment of PECAM-1/VE-cadherin/VEGFR2 complex formation under flow

• Analysis of PI3K activation downstream of the mechanosensory complex

How can researchers reconcile contradictory findings about PECAM-1 function in different experimental systems?

The literature contains seemingly contradictory findings about PECAM-1, which can be addressed through:

Context consideration:

• Vascular bed differences (brain vs. peripheral vessels)

• Acute vs. chronic inflammation models

• In vitro vs. in vivo settings

• Species differences (human vs. mouse models)

Technical reconciliation approaches:

• Direct comparison studies using standardized protocols

• Careful characterization of experimental conditions

• Use of multiple complementary techniques

• Multi-parameter analysis in a single experimental system

Biological explanations for contradictions:

• PECAM-1 displays context-dependent functions

• Different binding partners engage different signaling pathways

• Post-translational modifications (glycosylation) affect function

• Temporal dynamics of PECAM-1 engagement differ across models