T7 RNAP
Description
Promoter Recognition and Mechanism
T7 RNAP binds a 17-bp promoter sequence, initiating transcription at a guanine residue (position +1). The consensus promoter sequences for T7 and related phages are:
| Phage | Promoter Sequence (5'→3') | Transcription Start |
|---|---|---|
| T7 | TAATACGACTCACTATAGGGAGA | *G |
| T3 | AATTAACCCTCACTAAAGGGAGA | *G |
| SP6 | ATTTACGACACACTATAGAAGAA | *G |
Key Stages of Transcription:
-
Initiation: Binds promoter, melts DNA, and synthesizes short abortive transcripts (2–10 nt) .
-
Elongation: After synthesizing ~10 nt, the PBD rearranges, releasing the promoter and forming a stable elongation complex .
-
Termination: Occurs at specific signals or via run-off transcription, often producing 3′-heterogeneous RNA .
Applications in Biotechnology
T7 RNAP is a cornerstone tool due to its:
-
High Specificity: Exclusively transcribes templates downstream of T7 promoters .
-
Processivity: Synthesizes full-length transcripts >20 kb without dissociation .
-
Versatility: Used in:
Engineered Variants and Recent Advances
To address limitations like immunostimulatory byproducts (e.g., dsRNA), rational engineering has yielded improved T7 RNAP mutants:
| Mutant | 3′ Homogeneity | RNA Yield (vs. Wild-Type) | Key Improvement |
|---|---|---|---|
| Wild-Type | 6% | 100% | Baseline |
| 884G | 45% | 100% | Reduced dsRNA and run-on RNA |
| 884A | 65% | 85% | Enhanced termination fidelity |
These mutants minimize dsRNA formation, critical for therapeutic mRNA applications . Additionally, T7 RNAP can bypass template strand gaps up to 24 nt, enabling synthesis of internally deleted transcripts .
Industrial and Therapeutic Relevance
-
Biomanufacturing: Scalable RNA synthesis for diagnostics and therapeutics .
-
Gene Expression Systems: Paired with rifampicin-resistant E. coli strains for high-yield protein production .
-
Structural Insights: Cryo-EM and crystallography studies guide enzyme engineering for improved performance .
Limitations and Challenges
Product Specs
The enzyme T7 RNA polymerase actively synthesizes RNA, exceeding the rate of E. coli RNA polymerase, and exhibits frequent transcription termination. Demonstrating high selectivity, it primarily initiates transcription at its specific promoter sequences and exhibits resistance to antibiotics that typically inhibit E. coli RNA polymerase. Leveraging its ability to generate full-length RNA transcripts with exceptional reliability, T7 RNA polymerase facilitates in vitro mRNA transcription. However, it's important to note that T7 RNAP can also produce immunostimulatory byproducts like dsRNA, potentially impacting protein expression.
Recombinant T7 RNA polymerase is produced through the expression of bacteriophage T7 DNA within a recombinant E. coli bacterial system.
Functioning as a DNA-dependent 5'→ 3' RNA polymerase, T7 RNA Polymerase exhibits specific recognition of T7 promoter sequences.
The transcription buffer is composed of 40mM Tris-HCl (pH 8.0 at 25°C), 20mM MgCl2, 2.5mM TCEP, and 2mM spermidine.
The product remains stable for two years when stored at -20°C, and for two weeks at 4°C. It is crucial to avoid storage at -70°C.
One unit (1U) of enzyme activity is defined as the quantity necessary to incorporate 1 nanomole (nmol) of [3H]-labeled ATP into acid-insoluble precipitates over a period of 1 hour at a temperature of 37°C and a pH of 8.0.
This enzyme is utilized in the synthesis of various RNA molecules, including:
- Single-stranded RNAs (ssRNAs)
- Highly specific RNA probes, which can be either labeled or unlabeled
- Capped mRNA molecules, synthesized using cap analogues
Analysis by SDS-PAGE reveals a purity greater than 95%.
T7 RNAP.
T7 Bacteriophage RNA Polymerase gene
Product Science Overview
T7 RNA Polymerase is a DNA-dependent RNA polymerase derived from the T7 bacteriophage, a virus that infects Escherichia coli (E. coli) bacterial cells. This enzyme is highly specific for the T7 promoter sequence, making it a powerful tool for in vitro transcription and recombinant protein production.
The T7 RNA Polymerase system was developed in the 1980s at the U.S. Department of Energy’s Brookhaven National Laboratory. The sequencing and annotation of the T7 bacteriophage genome enabled scientists to clone the T7 RNA polymerase gene and use it for transcription of various genes . This system has since become one of the most successful biotechnologies, licensed by over 900 companies and generating significant revenue for the laboratory .
The T7 RNA Polymerase system operates by integrating a T7 promoter and a gene of interest into an expression vector, which is then transformed into E. coli cells. The E. coli cells contain a gene that produces T7 RNA polymerase under the control of a lac promoter. Normally, both the lac promoter and the T7 promoter are repressed by the Lac repressor. To initiate transcription, an inducer such as IPTG is added to bind to the Lac repressor, allowing the T7 RNA polymerase to be produced and bind to the T7 promoter on the expression vector, thereby transcribing the gene of interest .
T7 RNA Polymerase is widely used for generating specific RNA transcripts in vitro from DNA containing the T7 promoter sequence. These RNA transcripts are used in various applications, including:
The T7 RNA Polymerase system offers several advantages:
One of the challenges associated with the T7 RNA Polymerase system is “leaky” expression, where the recombinant protein is expressed even in the absence of an inducer. This can be problematic when the recombinant protein is toxic to the host cell. To mitigate this, vectors often include lac operator sequences downstream of the promoter to reduce leaky expression .
